Query (optional)   in Class  

GrainGenes Sequence Report: Tdurum_contig81460_347

[Submit comment/correction]

Sequence
Tdurum_contig81460_347
Contig
4BS_4948853
Species
Triticum aestivum
Probe
Tdurum_contig81460_347
DNA
gactactagaccaaccatgggtccgtcgttccggtggccatgcatgaatg
Matctttctttatgttttctgcgcgtgtatgatgtcgagggtgagggtga
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.