Query (optional)   in Class  

GrainGenes Sequence Report: WG114-3

[ Printable Version ]  [ Submit comment/correction ]

Sequence
WG114-3
Data Source
Kuenzel, Gottfried98.05.05
Probe
WG114
DNA Homology
MYCSRPM54A121noncereal_BlastN
[ Show all 6 ]
DNA
ttatcaagctcgcgacgtccaaactctgaaatgttgttgaaccatcctcc
tctgcattatcctctgaaatgtcaattgattcatccttgactcttcatca
ttgtacaattatttctctttcaccctctgtcccaacagccatgagtatct
gtaaactgaaggatct
BLAST
BLAST Search