Query (optional)   in Class  

GrainGenes Sequence Report: WHE07A02.s2

[ Printable Version ]  [ Submit comment/correction ]

Sequence
WHE07A02.s2
DNA Homology
GGU47276147noncereal_BlastN
[ Show all 605 ]
DNA
cgcacagcaatggcggcggaagaagcagccgcctccgcctccgccgccgc
caccaacttcgaggtggacctgggccacctcctggcntacgacccttcgc
accacctcgccgccgccgcngncgcgtcctccagggncgagctgcgggan
gagtgcctgcggaaggccacggagctggcgcaggccgtcgccaacgccct
cttctngctgccggccaccgagggccgtgatggncnctcngtttggcttg
cgggggtttntnantggagttcctggtatganttnttttcngnngggcgg
tttttntttttcnanttngggtanantttctggtagttgaaaggggtttt
ttcnnggtccaagttttgttnagnngnntngttgggnnggntgnaaagta
tttttgttggantgggggtttttggggttattnnntngntttaaattntn
tngtnngttgttccnntttttngnnngcntntttttganngtgngnngng
gtttnatnttttngtgtnannanggganttt
BLAST
BLAST Search