Query (optional)   in Class  

GrainGenes Sequence Report: WHE07B02.s2

[ Printable Version ]  [ Submit comment/correction ]

Sequence
WHE07B02.s2
DNA Homology
RICYK1596rice_BlastN
[ Show all 497 ]
DNA
ccgccgcctcctcctctccgctccttctccttccttcgagtttcagccat
gggtaagganaagactcacatcaacatcgtggtcattggccatgtcgact
ctggcaagtcgaccaccactggccatctgatctacaagcttggaggtatt
gacaagcgngtgatcgagaggttcgagaaggaagccgctgagatnancaa
gaggtctttcaagtacgcctgggtgcttnanaagctgnaggccgagcgng
aganggggnatcancattgatnttgncctgtggaagtncgngtaccatca
agtannantgnagngntcantggnngcccctggtncntcgtngngtgtca
tnnggngnnngganttantggttncnnnnnaggnttggattgtgtngggg
ntnntctattgtnnttcgatcctncntgntggnttttgngggcggnnngt
ncncganggtatggntnagtcccgtggnnnatggttgnttgnttttcatn
tngnngnggaattngntgtngtgtttt
BLAST
BLAST Search