Query (optional)   in Class  

GrainGenes Sequence Report: WHE07B04.s2

[ Printable Version ]  [ Submit comment/correction ]

Sequence
WHE07B04.s2
DNA Homology
D50571225oat_BlastN
[ Show all 65 ]
DNA
aaaaccctagccgccgccgccccaggtaagggagagagcccaccccacgc
cgccgccatgaagcgcaacccccgcgtcacgagctcccgccggaagtgcc
gcaaggcacttcacggcgccgtcctccgtccgccgcgtgctcatgtccgc
ggccctctcctctgagctccgccacaaatacaatgtccggtccatcccca
tccgcaagatgacgangtgcaggtcgtgcgcggcaccttcaagggccgcg
anggaaaggtggtgcagtctaangnngccggtgggttcatccaagtggag
cggttnacnagggngangttnatnggnttnnnaggtgaaagttggcattt
nccntaggnaagggtnttnntncattaangtttttangtttgtttaaggt
nccgttngggtccttctttgatngntaagtttngtggnccgngcttnttg
ttannggtnaatgngnnaatttnattggtngaggaatttnnnntngtngt
tggngngtttnnnngctttt
BLAST
BLAST Search