Query (optional)   in Class  

GrainGenes Sequence Report: WHE07C04.s2

[ Submit comment/correction ]

Sequence
WHE07C04.s2
DNA Homology
TASBEI660wheat_BlastN
[ Show all 43 ]
DNA
ccgccatcgacgaagatgctctgcctcaccgccccctcctgctcgccatc
tctcccgccgcgcccctcccgtcccgctgctgaccggcccggaccgggga
tctcgggcggcggcaatgtgcggctgagcgcggtgcccggncctcttcgc
tccgctggtcgtggccgcggaaggccaagagcaagttctctgttcccgtg
tctgcgccaagagactacaccatggcaacagctgaagatggtgttggcga
ccttccgatatacgatctggatccgaagtttgccggcttncaangaanan
tttcagtntataggatnaaaaagtacnttgaccaggaaanntttcgattg
annaagtatgntngaggtcttntangnantttttttanngggctatttna
ngtttnggntgcaanannngtntatgtnngtanntttntntnggggaant
nggttcntntnnttattggtnntntaattgtnttgngnnttgtantnttg
gntttgnntntgnttt
BLAST
BLAST Search

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.