Query (optional)   in Class  

GrainGenes Sequence Report: WHE07G09.s2

[ Printable Version ]  [ Submit comment/correction ]

Sequence
WHE07G09.s2
DNA Homology
TACM1331wheat_BlastN
[ Show all 501 ]
DNA
agcaacgggagctcacatatgcatatatgcatgccacacatccacggacg
gagcatgcttattcattcatgggcgacggatctatctatctttatatgtc
caaaccgaggcagtatggggcgttgtgaacggtcatcacgttgcagtgcc
ccggcgtaacgagcaccttggcgaatccctctggggctccctggggcatc
cggggaggtccttgagcacgctggaattgggatcagacctcgtgccgaat
tcctgcagcccgggggatccactagttctagagcggccgccaccgcgtng
gagctccagcttttgtttccctttagtgaagggtttaatttcganccttg
gcgttaaatcanggtccatanctgtttccctgtggtgaaaattgtttanc
cgctnnaaaatttccacacaaacntacgnagncggnaagccataaagtgt
taaaagccttggggtnncctaaatgnnntgngctaactcnacnttaattt
gcgt
BLAST
BLAST Search