Query (optional)   in Class  

GrainGenes Sequence Report: WHE07G11.s2

[ Printable Version ]  [ Submit comment/correction ]

Sequence
WHE07G11.s2
DNA Homology
ZMALTUB3123corn_BlastN
[ Show all 185 ]
DNA
gacacttgttccacgaagtacgtaatgatgcagttcaacagcgacataga
aagcaccgatggcttaacaacccaacacccagacacaagtctccaaaaca
ggacagcacagcaacatgtagttaaagataggcggcagaggagacggatc
ctccgtcgagcggacgagcagatcagtagtcgtcgtcctcctcgccatca
tcgtcgtcgccgccctctgcgcnganctcctcgttngtccttctccangg
cggccaagtcntcacnggncctcggagaaantcgncctcctccatngcnc
tcgnccncgtagcanntggcaagaanggcggggctttgggngtaacatgg
nggtcgnaacttgttggtcgaattgcggtggagtnagtacttggnngnag
ganngngtgggnttntggngtattcnnggtcggncgggnccnnttnggan
nattgnggctggntngtcnggtcggggganccngggttgnnngttnnntn
nattnnntngntcnntttnnanntc
BLAST
BLAST Search