Query (optional)   in Class  

GrainGenes Sequence Report: WHE07H06.s2

[ Submit comment/correction ]

Sequence
WHE07H06.s2
DNA Homology
VCISGMR164noncereal_BlastN
[ Show all 458 ]
DNA
gccgattccactaggttttccagctctcccgcacccgccgccgccacctc
cccactccccaccaccccctcagccatggcggtcgtcgagccggtgcccg
ggggcgacgtgaagctattcaaccgctggaccttcgaggatgttcaggtg
agcgacatctcgctgaacgactacctcgcggtgacgtcgatgaancacta
caccttcctgccgcactcggccggccgctactcggccaagcgcttccgca
agcgcagtgncccatcatcgagcgcctcancaactccctnatgttntang
gggcgnaacaacggtannnaagnttnatggncgtttcggatcatnaagca
taccntgggagtntcatcnagtttttttacngttntgnaanccnnttcca
nattnggntgtangcntntnatnnaananttggtnnangtnntgtntntt
agccgtnttgggngtnntgggggttnttnnatgagnngngggtnt
BLAST
BLAST Search

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.