Query (optional)   in Class  

GrainGenes Sequence Report: WHE09C01.s1

[ Printable Version ]  [ Submit comment/correction ]

Sequence
WHE09C01.s1
DNA Homology
WHTTEF1X492wheat_BlastN
[ Show all 1085 ]
DNA
accnccnccgcctcccctccggttcgttcttcttcttcgggttggggtag
tttacgtctacccaccagccatgggtaaggagaagactcacatcaacatc
ntggtcattggccacgtcgactctggtaagtcgacgaccactgggccacc
tgatntacaagcttgggaggcattgacaagcgtgtcatcgagaggttcga
gaaggaagccgctgaaatgaacaagaggtctttcaagtacgcctgggtgc
ttganaagctcaaggccgagcgtggagagaggtatcaccatcgatattgc
tctctggnaggttcggagannannangtacnaatgcnaccgtccgattgg
atggcncctggtncancntngagtntcgtcnaagnnacgatggatgcgag
cgggnaggctcnncaggcgtgganntggggntggngcctnnatgnaangn
ggggccgagccagttggtgggnttnggnggngggnnanctccccaagggn
gggcccagaggangtggggcangctntt
BLAST
BLAST Search