Query (optional)   in Class  

GrainGenes Sequence Report: WHE09F03.s1

[ Printable Version ]  [ Submit comment/correction ]

Sequence
WHE09F03.s1
DNA Homology
HVADH1182barley_BlastN
[ Show all 247 ]
DNA
ggtgaaatgagagatcagttctcgatttcgattccggggtccagagaatt
ccccaggcgaccgagcgaggatggcgaccgccggggaaggtgatcaagtg
caaagccgcggtggcgtgggaggcggntgaagccgctgtccatggaggga
ggtggaggtgggcnccgccgcagccatgggaggtgcgcgtcaagatcctc
ttcacctccctctgccacaccgacggtctacttctgggaggccaaggnnc
agacccccatgttccctcgngntctttcggtcatgnagctggnnggcgat
antnngangattntntggagaagggtgngannggnngttggccccngggt
ggaancnanntgngncccgtggngtngcacngtgggannggttaaggnan
atggcnncnnattttgcaaatgttgcgggaagggnagnatatgntgannn
gngggcccagggntnganagggnggananaaggtggnnnaggannggggg
gatggnnngnnnagggttngntgangnnngggnant
BLAST
BLAST Search