Query (optional)   in Class  

GrainGenes Sequence Report: WHE10B04.s1

[ Submit comment/correction ]

Sequence
WHE10B04.s1
DNA Homology
VFNUREPRA735noncereal_BlastN
[ Show all 260 ]
DNA
ctgcccccctccacacccgtgccgccgccgccgtcgccgcccgcgtcccc
ccatggcgctgccgaaccagaacaccgtcgattaccccagcttcaagctc
gtcatcgtcggcgatggcgggactggcaaaaccacttttgtgaagaggca
tctcactggagagtttgagaagaaatacgagcccaccattggtgttgaag
ttcacccattggatttcaccactaactgcggaaagatccgtttctactgc
tggngacactggctgggccaagagaagttttnggtggcctttagagaatg
gatactanatccatggtccggngtngcganttnatcatgntttggatgtc
cacttgcannggcttgatcttancnaggaatgttncctaangtgggncac
aggggacctgtggcaaggggttntggngagnanaatccccnaatggncct
gttgcgggcaancnaggttngangttgaaagt
BLAST
BLAST Search

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.