Query (optional)   in Class  

GrainGenes Sequence Report: WHE10B09.s1

[ Printable Version ]  [ Submit comment/correction ]

Sequence
WHE10B09.s1
DNA Homology
AF036500970noncereal_BlastN
[ Show all 535 ]
DNA
gttcacgcccggtcgtactcataaccgcatcaggtctccaaggtgaacag
cctctggccaatggancaatgtaggcaagggaagtcggcaaaacggatcc
gtaacttcgggaaaaggattggctctgaggantgggctcgggggtcccgg
cnccgaacccgtcggctgtcggcggattgctcgagctgctcangcggcga
gagcnggtcgccgcgtgtncggcngggaggangggngcggtnanntcttc
ccctgtntggggtnttttgccncggancaattgtanncggntcggtntcc
anagnactgggttactgnngacagngggnaattcccggncttgttttgan
tttagnagnngnnnngccnttttngganttngntccctncggggnnngtn
gngagnngcnantgttngattngnttgnccnnntngttgntggaanngnt
nnnagntngnntntnnntgtnanncnagggntgggnnttaaaanggnggg
nnntttaanncnnttggtnnt
BLAST
BLAST Search