Query (optional)   in Class  

GrainGenes Sequence Report: WHE10F06.s1

[ Printable Version ]  [ Submit comment/correction ]

Sequence
WHE10F06.s1
DNA Homology
CHZM23S101corn_BlastN
[ Show all 419 ]
DNA
ggcacccagagacgaggaagggcgtanaagcgacgaaatgcttcggggag
ttgaaaataagcatagatccggagattcccaaataggtcaaccttttaaa
ctgcctgctgaatccatgagcaggcaagagacaacctggcgaactgaaac
atcttagtagccagaggaaaagaaagcaaaagcgattcccgtagtagcgg
cgagcgaaatgggagcagcctaaaccgtgaaaacgnggttgtgggnagag
caatacaagcgttgtgctggctatgcgaacggtttgtagtgccgcaccct
tngatggctaaagtccanttagncgaaangcgatcacttagctttangnt
ctgaccctngttagnctgggggcacntggtaatccccgtgtgnatccngn
aaggagccancttgcaggctaanttantcctgggggggagnggntngtct
ngntngtnncgtntagggtaaagggtggaaagaaaccccccatnggttnn
tgnan
BLAST
BLAST Search