Query (optional)   in Class  

GrainGenes Sequence Report: WHE10F08.s1

[ Submit comment/correction ]

Sequence
WHE10F08.s1
DNA Homology
RICHTNP1155rice_BlastN
[ Show all 155 ]
DNA
ccgcaacctcccacaaatctccgccggccctccccttccgacccgcacag
gccgcagcagagcgccatgtcgtcctcccctacccccgcgccagacgccg
gcgccgccgcgatggccgtcgacgactcgtcggagaccgaccagctcgac
tccatgtccacggaggacatcgtccgggccacccgcctcctcgacaacga
ggtccgcgtcctcaaggacgagctgcagcgggaacaacctggagctcgag
aacgtcaaggacaagatcaaggagaaccaaggagaagataaagctcaaca
agcagctgcccttaccttcgtcggcaacatcgtcgagatattgggaaatg
aaccctgaaggatganggctggaaganggatggcggctattatngatctg
ggactcacggngggaaagggaaaatgtngtngtttcttaagaccntccac
aagacagacttatattccttcctgtggatcggggctagttggacctt
BLAST
BLAST Search

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.