Query (optional)   in Class  

GrainGenes Sequence Report: WHE10F11.s1

[ Printable Version ]  [ Submit comment/correction ]

Sequence
WHE10F11.s1
DNA Homology
LEH33343noncereal_BlastN
[ Show all 744 ]
DNA
ctgagctgctcataaggaagcttcctttccagaggcttgttagggagatt
gcccaggacttcaagactgacctccgcttccagagccatgcgtgctggcc
cttcaggaggctgcagaggcctacttggtgggtctcttcgaggacaccaa
cctgtgcgccatccatgccaagcgcgtgaccatcatgcccaagggacatt
cagctggctaggaggatccgtggcggagagggcttaaggtgcntgctttt
gcntggtggggaatggctctggtgggcatctncgtctgnttttngctggc
tgaaacanctggntcatgngtccntgtangcttnntaantncttggtgcc
gtgggtggtgnngaaantanggtcnnnttanncggngntctggttgnaaa
ntaantatgttttcctagggagcctggggatcgantgtggtnnncgttgg
ggngntcctanaancantnncgccgtgtnngggggnnctaaagctggnan
t
BLAST
BLAST Search