Query (optional)   in Class  

GrainGenes Sequence Report: WHE10F12.s1

Sequence
WHE10F12.s1
DNA Homology
MZEACT1G438corn_BlastN
[ Show all 496 ]
DNA
ccaangccaacagagagaaaatgacccagatcatgttcgaaaccttcagt
tgcccagcaatgtatgttgcaatccaggccgttctgtccttgtatgccag
cngtcgaacaactggtattgtgctcgactctggtgatggtgtgagccaca
ctgttccnatctacgagggatacacgcttcctcatgctatccttcgtttg
gaccttgctggccgggacctcacgganaatctaatganggatcctcanag
aaagagggntactccctcagaancancccgntgnanggggaaanttnttc
angnggccnttngaggggggnangnnccgnntatngtnggtcccttggnn
tnannngncnngggagcttggnaacnggctanngggtgcaggntngcnnn
nggttgggtgtnggngttttgtggtngnngncctgtagnggtnnagggtg
nntanncantggnggttnaggangaggtnnncaggtgtggcccnggagng
BLAST
BLAST Search