Query (optional)   in Class  

GrainGenes Sequence Report: WHE10F12.s1

[ Printable Version ]  [ Submit comment/correction ]

Sequence
WHE10F12.s1
DNA Homology
[ Hide all but 1 of 496 ]
MZEACT1G438corn_BlastN
MZEACT1G451corn_BlastN
CHKBACTN796noncereal_BlastN
ATU37281789noncereal_BlastN
AB002819783noncereal_BlastN
NTU60495397noncereal_BlastN
NTU60495466noncereal_BlastN
SLMACT35769noncereal_BlastN
SLMACT5769noncereal_BlastN
U01352769noncereal_BlastN
D89627769noncereal_BlastN
PPARDB769noncereal_BlastN
SVSOAC1769noncereal_BlastN
MOZBEAC769noncereal_BlastN
PPACT760noncereal_BlastN
AF038150760noncereal_BlastN
ZMU60514420corn_BlastN
ZMU60513411corn_BlastN
ZMU60513424corn_BlastN
LRACTINPA751noncereal_BlastN
CREACTINB751noncereal_BlastN
AF035774742noncereal_BlastN
XLACTA2742noncereal_BlastN
ACACTIN742noncereal_BlastN
XTACTA2742noncereal_BlastN
OSRAC1742oat_BlastN
SAU68462742noncereal_BlastN
AB004047742noncereal_BlastN
NTU60494411noncereal_BlastN
NTU60494409noncereal_BlastN
NTU60493375noncereal_BlastN
NTU60493443noncereal_BlastN
SLU60481406noncereal_BlastN
SLU60481411noncereal_BlastN
ZMU60507384corn_BlastN
ZMU60507433corn_BlastN
LTACT1820733noncereal_BlastN
MMACTBR2733noncereal_BlastN
MUSACCYB733noncereal_BlastN
SABTACTIN733noncereal_BlastN
CVACTIN733noncereal_BlastN
LTACT1596733noncereal_BlastN
MMACTASM733noncereal_BlastN
PSACTIN733noncereal_BlastN
HSAC07733noncereal_BlastN
PSACTG733noncereal_BlastN
ATU27811370noncereal_BlastN
ATU27811445noncereal_BlastN
TGU10429728noncereal_BlastN
CPU90325727noncereal_BlastN
CFBACTIN724noncereal_BlastN
LTACT1567724noncereal_BlastN
HSACTB724noncereal_BlastN
MUSACTMEL724noncereal_BlastN
LTACT1603724noncereal_BlastN
MUSACTGCS724noncereal_BlastN
MMGACTR724noncereal_BlastN
OAU39357724noncereal_BlastN
CVU66585724noncereal_BlastN
LTACT1855724noncereal_BlastN
MMACTBR724noncereal_BlastN
LPACT11720noncereal_BlastN
GGAC01122noncereal_BlastN
GGAC01686noncereal_BlastN
ATU41998370noncereal_BlastN
ATU41998434noncereal_BlastN
BMACTA1715noncereal_BlastN
MMACTG1715noncereal_BlastN
HSACTCGR715noncereal_BlastN
OCRNAASMA715noncereal_BlastN
RRGAMACT715noncereal_BlastN
RNACTAV715noncereal_BlastN
HEU22506715noncereal_BlastN
D87407711noncereal_BlastN
ASACT211711noncereal_BlastN
ATU42007370noncereal_BlastN
ATU42007423noncereal_BlastN
DDU27837706noncereal_BlastN
HGACTS706noncereal_BlastN
XLACACR706noncereal_BlastN
D87740706noncereal_BlastN
D87738706noncereal_BlastN
XLACASR706noncereal_BlastN
BOVACT1706noncereal_BlastN
OCRNAGNMA706noncereal_BlastN
MUSACTPSE706noncereal_BlastN
SLMACTARD706noncereal_BlastN
PHTACTA706noncereal_BlastN
DCACTIN1704noncereal_BlastN
XELACTIN5A702noncereal_BlastN
AF026063702noncereal_BlastN
LPACT5702noncereal_BlastN
SLU60478375noncereal_BlastN
SLU60478407noncereal_BlastN
HSACTA697noncereal_BlastN
SKY13664697noncereal_BlastN
CYISAA1697noncereal_BlastN
LPACT3697noncereal_BlastN
LPU09652697noncereal_BlastN
DDU27835697noncereal_BlastN
PSU76193697noncereal_BlastN
D87406697noncereal_BlastN
AAU20287697noncereal_BlastN
HUMACTAM697noncereal_BlastN
GG5ACT1697noncereal_BlastN
PMU55046697noncereal_BlastN
GMU60499371noncereal_BlastN
GMU60499407noncereal_BlastN
AF014363695noncereal_BlastN
S79782694noncereal_BlastN
OSRAC1D344rice_BlastN
OSRAC1D432rice_BlastN
ASACT205693noncereal_BlastN
BGU53348693noncereal_BlastN
XELACTIN8A693noncereal_BlastN
HTU22507693noncereal_BlastN
NTU60492388noncereal_BlastN
NTU60492384noncereal_BlastN
MUSGAAC690noncereal_BlastN
DDU02282688noncereal_BlastN
DROFLIACT688noncereal_BlastN
MOTACTINX688noncereal_BlastN
LPU09651688noncereal_BlastN
DDU27833688noncereal_BlastN
DROACT8F688noncereal_BlastN
DROACT87E688noncereal_BlastN
STU60488688noncereal_BlastN
PRDNAACT688noncereal_BlastN
CRASAA2688noncereal_BlastN
MMPG119688noncereal_BlastN
DDU02283688noncereal_BlastN
DROACT7A2688noncereal_BlastN
DMACT87E688noncereal_BlastN
AB003910688noncereal_BlastN
GOOACTB688noncereal_BlastN
AC003923688noncereal_BlastN
CYIACTBA686noncereal_BlastN
OSRAC3361rice_BlastN
OSRAC3406rice_BlastN
D87739684noncereal_BlastN
CTEACTBB681noncereal_BlastN
DROACT791679noncereal_BlastN
SKY13665679noncereal_BlastN
ECCACT679noncereal_BlastN
AF012125679noncereal_BlastN
BLY13663679noncereal_BlastN
XLACTA379noncereal_BlastN
XLACTA387noncereal_BlastN
SLU60482387noncereal_BlastN
SLU60482370noncereal_BlastN
STU60487384noncereal_BlastN
STU60487373noncereal_BlastN
AB004534672noncereal_BlastN
AF035422672noncereal_BlastN
SPACT1672noncereal_BlastN
YSPL972A672noncereal_BlastN
BMACTA2670noncereal_BlastN
DROACT88F670noncereal_BlastN
GMU48856670noncereal_BlastN
CELM03F4670noncereal_BlastN
MUSACTCM670noncereal_BlastN
CEACTIN4N670noncereal_BlastN
SCMACTIN670noncereal_BlastN
S63494670noncereal_BlastN
AF002685361noncereal_BlastN
AF002685389noncereal_BlastN
XBACT3A379noncereal_BlastN
XBACT3A378noncereal_BlastN
PCIAACT666noncereal_BlastN
U18102666noncereal_BlastN
BLY13662666noncereal_BlastN
RATACCYB663noncereal_BlastN
RNAC01663noncereal_BlastN
TRU37499663noncereal_BlastN
BMACTA3662noncereal_BlastN
BMU49854662noncereal_BlastN
HAACTA3B662noncereal_BlastN
HAACTA3A662noncereal_BlastN
BMU49644662noncereal_BlastN
CVU66587249noncereal_BlastN
CVU66587495noncereal_BlastN
HSSMGA661noncereal_BlastN
DROACT5CX661noncereal_BlastN
DROACT79B661noncereal_BlastN
STU60486661noncereal_BlastN
SLU60479661noncereal_BlastN
SCLTB34X661noncereal_BlastN
SCMUSACT661noncereal_BlastN
AGACT1DC661noncereal_BlastN
MMACTCR661noncereal_BlastN
AGACT1DA661noncereal_BlastN
AGACT1DB661noncereal_BlastN
PCIIBACT657noncereal_BlastN
AF017427657noncereal_BlastN
RATACTGE657noncereal_BlastN
ASACT302655noncereal_BlastN
STPOAC71366noncereal_BlastN
STPOAC71373noncereal_BlastN
DDU27836654noncereal_BlastN
S74868654noncereal_BlastN
TCU20234654noncereal_BlastN
MUSGA113noncereal_BlastN
MUSGA628noncereal_BlastN
SCLTB12X652noncereal_BlastN
PSU76192652noncereal_BlastN
SMU19945652noncereal_BlastN
CET04C12634noncereal_BlastN
CET04C12652noncereal_BlastN
CEACT2652noncereal_BlastN
BCCACTINA652noncereal_BlastN
PCU61733652noncereal_BlastN
PSU76191652noncereal_BlastN
PSU76190652noncereal_BlastN
TRBACTA652noncereal_BlastN
RRALPHAAC652noncereal_BlastN
CGU20114649noncereal_BlastN
ATU27980334noncereal_BlastN
ATU27980401noncereal_BlastN
STPOAC97348noncereal_BlastN
STPOAC97385noncereal_BlastN
DDIACT15648noncereal_BlastN
MLGMUSCACT648noncereal_BlastN
FRU38850366noncereal_BlastN
FRU38850369noncereal_BlastN
NTU60489348noncereal_BlastN
NTU60489381noncereal_BlastN
DDU27834645noncereal_BlastN
FNACTIN645noncereal_BlastN
GMU60505374noncereal_BlastN
GMU60505353noncereal_BlastN
C25963963rice_EST
H77027789noncereal_EST
RICS1867A778rice_EST
T42293778noncereal_EST
H36835778noncereal_EST
AA067462775noncereal_EST
N38151772noncereal_EST
R30534747noncereal_EST
AA308804736noncereal_EST
AA325428733noncereal_EST
AA307555733noncereal_EST
AA373608733noncereal_EST
AA310285728noncereal_EST
AA314297727noncereal_EST
AA145739724noncereal_EST
AA205033724noncereal_EST
AA520303724noncereal_EST
AA138737724noncereal_EST
AA520005724noncereal_EST
AA681948724noncereal_EST
AA529157724noncereal_EST
AA637064724noncereal_EST
AA538099724noncereal_EST
AA172947724noncereal_EST
AA531887724noncereal_EST
AA561220724noncereal_EST
AA562840724noncereal_EST
AA306934721noncereal_EST
C02631720noncereal_EST
AA330957718noncereal_EST
T04154716noncereal_EST
AA519660715noncereal_EST
AA683820715noncereal_EST
AA520337715noncereal_EST
AA437640715noncereal_EST
AA387052715noncereal_EST
AA119180715noncereal_EST
W22073712noncereal_EST
AA307358709noncereal_EST
AA139924706noncereal_EST
AA305285700noncereal_EST
AA485467697noncereal_EST
AA570728697noncereal_EST
AA569733697noncereal_EST
AA310561696noncereal_EST
AA686420696noncereal_EST
AA359542695noncereal_EST
AA372166694noncereal_EST
AA347544694noncereal_EST
AA336905694noncereal_EST
W28606691noncereal_EST
AA312444691noncereal_EST
C04910691noncereal_EST
AA361828690noncereal_EST
AA469746690noncereal_EST
AA695270690noncereal_EST
AA265608690noncereal_EST
AA660789689noncereal_EST
AA391359688noncereal_EST
AA263797688noncereal_EST
AA439790688noncereal_EST
AA537022688noncereal_EST
AA660796688noncereal_EST
AA696405688noncereal_EST
AA651688688noncereal_EST
AA373440688noncereal_EST
AA316035687noncereal_EST
AA380451687noncereal_EST
C24777686rice_EST
AA374204685noncereal_EST
AA313536682noncereal_EST
AA324411682noncereal_EST
AA117777681noncereal_EST
AA346838679noncereal_EST
AA697699679noncereal_EST
AA567480679noncereal_EST
AA073289679noncereal_EST
AA646493679noncereal_EST
AA366397678noncereal_EST
C04447676noncereal_EST
AA286007675noncereal_EST
AA311283675noncereal_EST
AA597266675noncereal_EST
N40776674noncereal_EST
AA214715189noncereal_EST
AA214715560noncereal_EST
AA370494673noncereal_EST
AA360049433noncereal_EST
AA360049311noncereal_EST
AA668024672noncereal_EST
AA644843670noncereal_EST
AA222303670noncereal_EST
AA240958670noncereal_EST
AA221440670noncereal_EST
AA269501670noncereal_EST
AA305007669noncereal_EST
H35028491noncereal_EST
H35028250noncereal_EST
W22867667noncereal_EST
AA352546430noncereal_EST
AA352546308noncereal_EST
AA307388666noncereal_EST
H69615666noncereal_EST
AA378240430noncereal_EST
AA378240308noncereal_EST
AA373920430noncereal_EST
AA373920308noncereal_EST
AA710883665noncereal_EST
AA386104664noncereal_EST
AA138604664noncereal_EST
AA351532430noncereal_EST
AA351532308noncereal_EST
AA306338630noncereal_EST
AA306338108noncereal_EST
AA306023430noncereal_EST
AA306023308noncereal_EST
AA353496661noncereal_EST
AA520703661noncereal_EST
AA354556659noncereal_EST
AA080183545noncereal_EST
AA080183190noncereal_EST
W23208658noncereal_EST
AA142646545noncereal_EST
AA142646190noncereal_EST
T14477657noncereal_EST
AA545742656noncereal_EST
AA351474427noncereal_EST
AA351474302noncereal_EST
AA104276536noncereal_EST
AA104276195noncereal_EST
AA518202536noncereal_EST
AA518202195noncereal_EST
AA619528536noncereal_EST
AA619528195noncereal_EST
AA582632325noncereal_EST
AA582632404noncereal_EST
AA266086536noncereal_EST
AA266086195noncereal_EST
AA472868421noncereal_EST
AA472868308noncereal_EST
AA196110422noncereal_EST
AA196110307noncereal_EST
AA114649421noncereal_EST
AA114649308noncereal_EST
M78470652noncereal_EST
AA141983652noncereal_EST
AA088162652noncereal_EST
M88939652noncereal_EST
AA162804446noncereal_EST
AA162804283noncereal_EST
AA162609421noncereal_EST
AA162609308noncereal_EST
AA296112524noncereal_EST
AA296112198noncereal_EST
AA214989536noncereal_EST
AA214989190noncereal_EST
AA300146524noncereal_EST
AA300146198noncereal_EST
AA612484536noncereal_EST
AA612484190noncereal_EST
AA497555441noncereal_EST
AA497555283noncereal_EST
AA386110524noncereal_EST
AA386110198noncereal_EST
AA537613441noncereal_EST
AA537613283noncereal_EST
AA337871648noncereal_EST
AA591755446noncereal_EST
AA591755278noncereal_EST
AA671305421noncereal_EST
AA671305302noncereal_EST
AA333040523noncereal_EST
AA333040195noncereal_EST
AA073638536noncereal_EST
AA073638185noncereal_EST
AA352010524noncereal_EST
AA352010195noncereal_EST
AA313698524noncereal_EST
AA313698195noncereal_EST
AA561624413noncereal_EST
AA561624308noncereal_EST
AA660462644noncereal_EST
AA315160524noncereal_EST
AA315160195noncereal_EST
HSB98H012643noncereal_EST
AA673386536noncereal_EST
AA673386185noncereal_EST
AA317963524noncereal_EST
AA317963189noncereal_EST
AA004064639noncereal_EST
AA296297521noncereal_EST
AA296297189noncereal_EST
T14366637noncereal_EST
AA305669523noncereal_EST
AA305669189noncereal_EST
AA312127422noncereal_EST
AA312127288noncereal_EST
H76490635noncereal_EST
AA296326518noncereal_EST
AA296326189noncereal_EST
AA656374634noncereal_EST
C11780634noncereal_EST
AA540641437noncereal_EST
AA540641274noncereal_EST
W14080197noncereal_EST
W14080510noncereal_EST
AA683818421noncereal_EST
AA683818284noncereal_EST
AA359348628noncereal_EST
AA102324427noncereal_EST
AA102324276noncereal_EST
AA468489385noncereal_EST
AA468489316noncereal_EST
AA321187512noncereal_EST
AA321187187noncereal_EST
AA306964508noncereal_EST
AA306964192noncereal_EST
AA335133527noncereal_EST
AA335133171noncereal_EST
AA356056625noncereal_EST
AA315790421noncereal_EST
AA315790279noncereal_EST
AA314465505noncereal_EST
AA314465195noncereal_EST
AA440210437noncereal_EST
AA440210263noncereal_EST
AA386284387noncereal_EST
AA386284308noncereal_EST
AA391674437noncereal_EST
AA391674263noncereal_EST
AA138589622noncereal_EST
M79632622noncereal_EST
AA034860621noncereal_EST
AA224301403noncereal_EST
AA224301292noncereal_EST
AA319384384noncereal_EST
AA319384308noncereal_EST
AA073927518noncereal_EST
AA073927177noncereal_EST
RICS4003A618rice_EST
AA153503618noncereal_EST
W83888615noncereal_EST
M79958614noncereal_EST
AA440872437noncereal_EST
AA440872254noncereal_EST
AA441155437noncereal_EST
AA441155254noncereal_EST
RICS3467A612rice_EST
H36768612noncereal_EST
AA145736353noncereal_EST
AA145736335noncereal_EST
AA540406611noncereal_EST
AA572415371noncereal_EST
AA572415316noncereal_EST
AA378687610noncereal_EST
AA310867610noncereal_EST
AA624965609noncereal_EST
AA333894488noncereal_EST
AA333894192noncereal_EST
R30740525noncereal_EST
R30740154noncereal_EST
AA373207523noncereal_EST
AA373207154noncereal_EST
AA082130604noncereal_EST
AA671548602noncereal_EST
AA523569601noncereal_EST
DNA
ccaangccaacagagagaaaatgacccagatcatgttcgaaaccttcagt
tgcccagcaatgtatgttgcaatccaggccgttctgtccttgtatgccag
cngtcgaacaactggtattgtgctcgactctggtgatggtgtgagccaca
ctgttccnatctacgagggatacacgcttcctcatgctatccttcgtttg
gaccttgctggccgggacctcacgganaatctaatganggatcctcanag
aaagagggntactccctcagaancancccgntgnanggggaaanttnttc
angnggccnttngaggggggnangnnccgnntatngtnggtcccttggnn
tnannngncnngggagcttggnaacnggctanngggtgcaggntngcnnn
nggttgggtgtnggngttttgtggtngnngncctgtagnggtnnagggtg
nntanncantggnggttnaggangaggtnnncaggtgtggcccnggagng
BLAST
BLAST Search