Query (optional)   in Class  

GrainGenes Sequence Report: WHE10G12.s1

[ Printable Version ]  [ Submit comment/correction ]

Sequence
WHE10G12.s1
DNA Homology
D50571216oat_BlastN
[ Show all 214 ]
DNA
aaaaccctagccgccgccgccccaggtaagggagagagcccaccccacgc
cgccgccatgaagcgcaacccccgcgtcacgagctccggccggaagtgcc
gcaaggcacttcacggcgccgtcctccgtccgccgcgtgctcatgtccgc
ggccctctcctctgagctccgccacaaatacaatgtccggtccatcccca
tccgcaaggatgacgaggtgcaggtcgtgcgcggcaccttcaaggggccg
cganggnaaangttgtgcaggtcttaacggcggncgttgggttcantcca
agtnggaangggattcaancaagggngnaaagntccaaattnggnttcaa
gggttaaaaggtttnggcnntccaaacccnnagtcaangnnnnttggttc
nacccangtttcaaaggttnnaannanggatccggnaaggggcccttctt
ttgaatngggnaaaggtttnngggggcngnnttngnttgaaanaaaggcc
nn
BLAST
BLAST Search