Query (optional)   in Class  

GrainGenes Sequence Report: WHE10H07.s1

[ Printable Version ]  [ Submit comment/correction ]

Sequence
WHE10H07.s1
DNA Homology
MSU12708638noncereal_BlastN
[ Show all 261 ]
DNA
cccacaaaaccctagccgtcgtctcacagctcgccgccgacgcagcgagc
tcttcctccaccgccgcaaccatggcgacccagatcagcaagaagaagaa
gtttgtgagcgatggcgttttctacgccgagctgaacgagatgctgaccc
gggagcttgccgaggacggctactccggcgtggaggtgcgcgtgacgccg
atgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttgg
tgagaagggccgcagatcaggggagctcacctccgtcgtccagaagcgct
tcaactttcccggangaanggcggttgaagttttacgccggagaagtcgt
canangttggccttcttgcggccatcggcccngggntgganntnactccg
gcntacaangntncttcgganggctttgccgtcccgcgnggcatggcnat
ggtgttntttcgctttgttatggaggattggngntaaaggttgtgaggg
BLAST
BLAST Search