Query (optional)   in Class  

GrainGenes Sequence Report: WHE10H07.s1

[ Printable Version ]  [ Submit comment/correction ]

Sequence
WHE10H07.s1
DNA Homology
[ Hide all but 1 of 261 ]
MSU12708638noncereal_BlastN
DROS3APEN631noncereal_BlastN
DMRPS3599noncereal_BlastN
RRRPS3572noncereal_BlastN
MMRIBPS3572noncereal_BlastN
HSHUMS3571noncereal_BlastN
HSU14991566noncereal_BlastN
HSU14990566noncereal_BlastN
S42658561noncereal_BlastN
XLRPS1A557noncereal_BlastN
S83098533noncereal_BlastN
XLRIBS1R509noncereal_BlastN
FRRPS3373noncereal_BlastN
FRRPS3192noncereal_BlastN
CELC23G10254noncereal_BlastN
CELC23G10259noncereal_BlastN
XLRIBS1G275noncereal_BlastN
XLRIBS1G168noncereal_BlastN
HUMRPS3X192noncereal_BlastN
SERCP450A137noncereal_BlastN
HUMASPX134noncereal_BlastN
HSU83867134noncereal_BlastN
HSU53204132noncereal_BlastN
HEHSV2US132noncereal_BlastN
HSPLEC132noncereal_BlastN
HSPLEC1S3132noncereal_BlastN
AB001348131oat_BlastN
SOEMHISON3127noncereal_BlastN
HUMSNF2LB126noncereal_BlastN
BVH1LFT31125noncereal_BlastN
GGSPECTA125noncereal_BlastN
BHV1CGEN125noncereal_BlastN
BHV1ULX125noncereal_BlastN
HUMERP72H125noncereal_BlastN
HCRPLCLU123noncereal_BlastN
HHRAPO123noncereal_BlastN
HSV2HG5283noncereal_BlastN
HSV2HG52132noncereal_BlastN
MZEDSPMBT122corn_BlastN
D89056121noncereal_BlastN
T23346656corn_EST
T23346172corn_EST
T23346290corn_EST
C26991262rice_EST
C26991756rice_EST
C24794222rice_EST
C24794762rice_EST
C2479495rice_EST
C28371232rice_EST
C28371768rice_EST
C72145292rice_EST
C72145106rice_EST
C72145663rice_EST
C28633222rice_EST
C28633747rice_EST
C26750871rice_EST
C2675090rice_EST
C74441272rice_EST
C74441102rice_EST
C74441516rice_EST
T44476692noncereal_EST
H36289686noncereal_EST
RICS4341A162rice_EST
RICS4341A597rice_EST
T21989683noncereal_EST
BNAESTF177661noncereal_EST
AA695581649noncereal_EST
T46338647noncereal_EST
T21526644noncereal_EST
H77161644noncereal_EST
H36296644noncereal_EST
AA651539635noncereal_EST
AA264874631noncereal_EST
AA439999631noncereal_EST
AA390929631noncereal_EST
AA567057631noncereal_EST
AA441207631noncereal_EST
H36097630noncereal_EST
H37417624noncereal_EST
AA661046624noncereal_EST
AA696454622noncereal_EST
AA393004622noncereal_EST
AA390625622noncereal_EST
AA694867622noncereal_EST
AA264799622noncereal_EST
C73748162rice_EST
C7374892rice_EST
C73748501rice_EST
AA660760615noncereal_EST
AA539612613noncereal_EST
AA264935613noncereal_EST
AA439074613noncereal_EST
AA695792613noncereal_EST
C26823157rice_EST
C2682393rice_EST
C26823491rice_EST
AA696495602noncereal_EST
C19305157rice_EST
C1930599rice_EST
C19305483rice_EST
T42166596noncereal_EST
AA061896592noncereal_EST
AA126108586noncereal_EST
N34116580noncereal_EST
AA053593580noncereal_EST
AA155935580noncereal_EST
AA272213579noncereal_EST
AA711421578noncereal_EST
AA269672572noncereal_EST
AA26967281noncereal_EST
AA602726576noncereal_EST
AA349669574noncereal_EST
AA299708574noncereal_EST
AA082170574noncereal_EST
N32700574noncereal_EST
AA321578574noncereal_EST
N27489574noncereal_EST
AA469577572noncereal_EST
AA038309572noncereal_EST
AA457936572noncereal_EST
AA462418572noncereal_EST
AA611099572noncereal_EST
W13696572noncereal_EST
AA245419572noncereal_EST
AA184439572noncereal_EST
AA646237572noncereal_EST
AA242481572noncereal_EST
AA049579572noncereal_EST
AA592032572noncereal_EST
AA028790572noncereal_EST
AA611468572noncereal_EST
AA237565572noncereal_EST
AA575010572noncereal_EST
AA242138572noncereal_EST
W35719572noncereal_EST
AA377653572noncereal_EST
AA547347572noncereal_EST
AA541994572noncereal_EST
AA106803572noncereal_EST
AA435008572noncereal_EST
AA117345572noncereal_EST
AA277776572noncereal_EST
AA197809572noncereal_EST
W85012572noncereal_EST
AA655581572noncereal_EST
AA511171572noncereal_EST
AA089265572noncereal_EST
AA038465572noncereal_EST
AA106219572noncereal_EST
AA197832572noncereal_EST
AA410127572noncereal_EST
AA155155572noncereal_EST
AA240235572noncereal_EST
AA422799572noncereal_EST
AA689740572noncereal_EST
AA396653572noncereal_EST
AA051351572noncereal_EST
AA038116572noncereal_EST
AA390182572noncereal_EST
AA685011572noncereal_EST
AA589202572noncereal_EST
AA230422572noncereal_EST
AA589793572noncereal_EST
AA474258572noncereal_EST
AA667044572noncereal_EST
AA048090572noncereal_EST
H73131571noncereal_EST
HUM075H08B571noncereal_EST
H74068571noncereal_EST
AA373238571noncereal_EST
H46197571noncereal_EST
AA316795571noncereal_EST
AA362667571noncereal_EST
R14448571noncereal_EST
AA315437571noncereal_EST
T58820571noncereal_EST
AA099531571noncereal_EST
AA313201571noncereal_EST
H50390571noncereal_EST
AA373367571noncereal_EST
H02174571noncereal_EST
AA652257570noncereal_EST
AA336582569noncereal_EST
AA315819569noncereal_EST
AA192134568noncereal_EST
T58274568noncereal_EST
AA101869568noncereal_EST
AA211638568noncereal_EST
AA377849568noncereal_EST
AA375831568noncereal_EST
R27196567noncereal_EST
AA695347477noncereal_EST
AA695347163noncereal_EST
AA135320566noncereal_EST
W16569566noncereal_EST
AA205135566noncereal_EST
AA158297566noncereal_EST
AA304511566noncereal_EST
AA373358566noncereal_EST
AA631957566noncereal_EST
AA313829566noncereal_EST
AA316665566noncereal_EST
T39462566noncereal_EST
HUM155C09B566noncereal_EST
AA085704566noncereal_EST
AA564493566noncereal_EST
AA360524566noncereal_EST
AA134167566noncereal_EST
HUM156B06B566noncereal_EST
AA188034566noncereal_EST
AA321698566noncereal_EST
AA313520566noncereal_EST
AA133998566noncereal_EST
AA126123566noncereal_EST
AA083660566noncereal_EST
AA375524566noncereal_EST
AA226844566noncereal_EST
AA313771566noncereal_EST
AA310316566noncereal_EST
AA380542566noncereal_EST
AA135820566noncereal_EST
AA313316566noncereal_EST
AA316022566noncereal_EST
AA315191566noncereal_EST
AA321348566noncereal_EST
R35518566noncereal_EST
AA581356566noncereal_EST
AA307496566noncereal_EST
W03574566noncereal_EST
T55972566noncereal_EST
AA352370566noncereal_EST
AA307354566noncereal_EST
W00698566noncereal_EST
AA483994566noncereal_EST
AA601907566noncereal_EST
AA176593566noncereal_EST
AA370100566noncereal_EST
AA313576566noncereal_EST
AA176672566noncereal_EST
AA314024566noncereal_EST
AA311554566noncereal_EST
AA306131566noncereal_EST
T54250566noncereal_EST
AA308253566noncereal_EST
AA602704566noncereal_EST
AA099934566noncereal_EST
AA316345566noncereal_EST
AA341855565noncereal_EST
AA377877565noncereal_EST
AA362505565noncereal_EST
H58827565noncereal_EST
AA299644565noncereal_EST
AA374278565noncereal_EST
AA409475565noncereal_EST
AA310471565noncereal_EST
AA378305565noncereal_EST
N30529564noncereal_EST
AA686664564noncereal_EST
AA356316564noncereal_EST
AA519771563noncereal_EST
AA073183563noncereal_EST
DNA
cccacaaaaccctagccgtcgtctcacagctcgccgccgacgcagcgagc
tcttcctccaccgccgcaaccatggcgacccagatcagcaagaagaagaa
gtttgtgagcgatggcgttttctacgccgagctgaacgagatgctgaccc
gggagcttgccgaggacggctactccggcgtggaggtgcgcgtgacgccg
atgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttgg
tgagaagggccgcagatcaggggagctcacctccgtcgtccagaagcgct
tcaactttcccggangaanggcggttgaagttttacgccggagaagtcgt
canangttggccttcttgcggccatcggcccngggntgganntnactccg
gcntacaangntncttcgganggctttgccgtcccgcgnggcatggcnat
ggtgttntttcgctttgttatggaggattggngntaaaggttgtgaggg
BLAST
BLAST Search