Query (optional)   in Class  

GrainGenes Sequence Report: WHE1901_A01_A01Z

[ Printable Version ]  [ Submit comment/correction ]

Sequence
WHE1901_A01_A01Z
Germplasm
Chinese Spring
Species
Triticum aestivum
DNA Library
TA005E2S
DNA
tccatgagcgtcccaaacgacgtgttcgctgccgccggttgtgctcggcc
gcatgtggatgcagtggtgggcgaggtgtgctctgaagccaccagcggct
ggacgcgcagggtcagggtgggtaaagctcccgaggagagggagatgaat
ccaaacaggatttcagctcccgaagtgtacaaattgtggtctgcttgggc
atcgacgcaataactgtggcacgaggaaatctggaccttttgaaccgaac
tttctctaaggaactaaattcataagtcgtgctgtttctttgtcaggact
gtcttattgtgcaatcatcattgtgtcatttgcactcggttgacaattaa
aactgttttatttggtctgttaaaaaaaaaaaaaaaaaa
BLAST
BLAST Search