Query (optional)   in Class  

GrainGenes Sequence Report: X07841

[ Printable Version ]  [ Submit comment/correction ]

Sequence
X07841
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Triticum aestivum (bread wheat)
Keyword
18S ribosomal RNA
25S ribosomal RNA
repetitive sequence
ribosomal DNA
ribosomal RNA
Species
Triticum aestivum
Data Source
genbankRelease 135, Apr 15 2003
Title
Wheat rDNA 25S-18S intergenic region EcoRI-BamHI fragment.
Clone
pTa71
Probe
pTa71
Gene Product
18S ribosomal RNA
25S ribosomal RNA
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'genomic DNA';
Locus Comment: Within the 25S-18S rDNA intergenic spacer 4 repeat families are; present. Family A consitsts of 12 direct repeats of ca. 135 bp,; family B of 3 direct repeats of ca. 150 bp, family C of 2 direct; repeats of ca. 173 bp and family D of 2 repeats of 30 bp lengths.
EMBL Feature
misc_feature4974085intergenic spacerLocation: 497..4085
[ Show all 7 ]
DNA
agcagaattcaccaagtgttggattgttcacccaccaatagggaacgtga
gctgggtttagaccgtcgtgagacaggttagttttaccctactgatgaca
gtgtcgcgatagtaattcaacctagtacgagaggaaccgttgattcacac
aattggtcatcgcgcttggttgaaaagccagtggcgcgaagcaccgtgtg
ccggattatgactgaacgcctctaagtcagaatccaagctagcatgcgac
gcctgcgcccgccgcccgccccgacccacgttaggggcgcttgcgcaagg
gcccgtgccattggctaagccggtccggccgaagtgccgcggccggccgc
ctcgaagctcccttcccaacgggcggtgggctgaatcctttgcagacgac
ttaaatacgcgacggggcattgtaagtggcagagtggccttgctgccacg
atccactgagatccagccccatgtcgcacggattcgtccctcccccacaa
ctttccttcaccaagtaaggttcgaagatgccatcaaaatctgcaccgca
aaatcatgaggactagaaatggctaagtcccttgtaagacatacccttgg
acccaataaggccagtggaaacaacactcaaaactatatgtgccgaatgc
aaaagatacttggccgattcatgcggatgccgtcgtcagaggctacactg
ctaagtcatggtcaaggcaaatggtatagtcccttatatgacatacacaa
tcactcaataaggccagtgacgagcacactcaaaagtatatgtgccaagt
gaacaagatacttgaccgattcattcggatgccttcatcaggctaaacgg
ctatgtcatggacaagacaaaatggtaaagtcccttgaatgaaatacgta
atcactcgataaggccagtcgcgagcacagtcaaaactatttgaggcaag
tgaccaagatacttcagcgattcatgtgtgcaactcatcacaaagacact
tacacggacccatgaacgggctgtacagggacacgggaaagaagtgcttg
acatacttcatggacggatgtggacgcgccccattgatcaccaggcaaaa
acacttaaagggagccgtgaacgggctgtacgaggacacgggaaaaaact
ggccgaccgccgtcgtggacggaagttgacgcgcgccatggaaaaccggg
caaaaccacgtacgtggcacacgccgcgtagacggacccttacacggagc
cgtgaacgggctgtacgtggacacgggaaaaaactggccgacggccgtcg
tggacggaagttgacgcgcgccatggaaaactgggcaaaaccacgtacgt
ggcacacgccgcgtacacggacccttacacggacccgtgaacgggctgta
cgtggacacgggaaaaaactggcgaacggccgtcctggacggaagtggac
gcgcgccatggaaaactaggcaaaaccacgtacgtggcacacgccgcgta
cacggccccttacacggacccgtgaacgggctgtacgtggacacaggaaa
aaagtgcccgacggccgtcgtggacggaagttgacgcgcgccatggaaaa
ctgggcaaaaccacgtacgtggcacacgccgcgtacacggccccttacac
ggacccgtgaacgggctgtacgtggacacgggaaaaaagtgcccgacggc
cgtcatggacggaagttgacgcgcgccatggaaaactgggcaaaaccacg
tacgtggcacacgccgcgtacacggacccttacacggacccgtgaacggg
ctgtacgtggacacgggaaaaaagtgcccgacggccgtcgtggacggaag
ttgacgcgcgccatggaaaactgggcaaaaccacgtacgtggcacacgcc
gcgtacacggacccttacacggagccgtgaacgggctgtacgtggacacg
ggaaaaaagtgcccgacggccgtcgtggacggaagttgacgcgcgccatg
gaaaactgggcaaaaccacgtacgtggcacacgccgcgtacacggaccct
tacacggaccccgtgaacgggctgtacgtggacacgggaaaaaagtgccc
gacggccgtcgtggacggaagttgacgcgcgccatggaaaactgggcaaa
accacgtacgtggcacacgccgcgtacacggacccttacacggaccccgt
gaacgggctgtacgtggacacgggaaaaaagtgcccggcggccgtcgtgg
acggaagttgacgcgcgccatggaaaactgggcaaaaccacgtacgtggc
acacgccgcgtacacggacccttacacggagccgtgaacgggctgtacgt
ggacacgggaaaaaagtgcccgacggccgtgctggacggaagttgacgcg
cgccatggaaaactgggcaaaaccacgtacgtggcacacgccgcgtacac
ggacccttacacggaccccgtgaacgggctgtacgtggacacgggaaaaa
agtgcccgacggccgtcgtggacggaagttgacgcgcgccatggaaaact
gggcaaaaccacgtacgtggcacacgccgcgtacacggacccttacacgg
agccgtgaacgggctgtacgtggacacgggaaaaaagtgcccgacggccg
tcgtgaacggaagttgacgcgcgccatggaaaactgggcaaaaccatgta
cgtggcacacgccgcgtacacggacccgtacacggacccgtgaacgggta
tgagaggtccgggaaaaaatggcccatacaccatgcgaaccggctcaaaa
ccagctaatgatggtcaacaaacggtgccatggcagcgaaaacatgtctc
atggcaaaaaaacgctgccacggcagcgtttcaaaacagtgtacccctcc
ttcacaaactaagggcaggggtcccaatgggggctaaaaccctcgggtat
agtagggaggaggggtccttcctggtgggcgtacggaacacgggtgattt
ttcttagggaaaacacccgtgttcacgtacgcccatcctttcccaacgtt
gcctcggatgtcccgtcgttatgccatcacgaaggtgttggcccggtccc
gtgtacgtctcgtgagaaattctgacccaacagccgaaggtagctcggga
aacaggaaagtaccccgttgcgtacacgatccgaccgacggtaaacagtc
gcaacgatgtccctccaatgtcgcctccggaaaaacgttgcccctcggtg
gcaacgtcatcgctgtcccggtcccctgtacgtctcaagtgaaattctaa
cccaacagccgaatgcggctcgggaaacaggaaagtagcccgtttcgtgc
acgataagaccgtccgacaacgttgcaccgatgtcccgataaagttgcct
ttggaaaatcgttgcatccgtagctttattgctgctggtgtgacacgcgt
gatttggccttgcaggacgccttcgtgcaagtgatcctcccgtgctatgc
atgggcggaggcttggttggtttgaccgcttgttggctactaagcgcatg
agtagctttggacccgtgtctgccggtagatcccccgttgtactgcggcc
gactaccggcgccgtgtcccgtccctcgtgtggcttcgaatcgctggatt
aatagtgcttgcgtgctagtacccgacctacgggaagtggtgcttcggat
aattgttgcctcgcggcggacgcccattgggtgtgccgctgcggccaaat
agcgcttgcggcgttgcctcgtggggctggcacattacgtgcccgttgct
atcaaggcaacctcgctcccgcttttggtctcggatgctgctcacgataa
agggtcgtggccctttcggttgcctcgacccgacccaaagctctccgaac
tgagaacaaccggaacaggacttgcctctacctctccacagttacgtggt
aggatacgcaactctctgcgccgatcctcaaggacgatgagctgtgccgc
tcaagagcgacaaccggcccggctgttgcctctgagtttccacgaaagtg
gaagcgcagaacgatggccgtgctggtagtcaccaaggacgtgctacctg
gttgatcctgccagtagtcatatgcttgtctcaaagattaagccatgcat
gtgcaagtatgaaccaatttgaactgtgaaactgcgaatggctcattaaa
tcagttatagtttgtttgatggtacgtgctactcggataaccgtagtaat
tctagagctaatacgtgcaacaaaccccgacttctgggaggggcgcattt
attagataaaaggctgacgcgggctctgctcgctgatccgatgattcatg
ataactcgacggatcgcacggccttcgtgccggcgacgcatcattcaaat
ttctgccctatcaactttcgatggtaggataggggcctaccatggtggtg
acgggtgacggagaattagggttcgattccggagagggagcctgagaaac
ggctaccacatccaaggaaggcagcaggcgcgcaaattacccaatcctga
cacggggaggtagtgacaataaataacaataccgggcgcattagtgtctg
gtaattggaatgagtacaatctaaatcccttaacgaggatcc
BLAST
BLAST Search