Query (optional)   in Class  

GrainGenes Sequence Report: X07931

[Submit comment/correction]

Sequence
X07931
Subsequence
X07931_1.cds15904383
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC192126
Data at Gramene
Gramene-Protein P09842
DB Remark
Locus Source: Hordeum vulgare subsp. vulgare
Keyword
starch synthase
waxy locus
Species
Hordeum vulgare subsp. vulgare
Clone Library
EMBL4
Tissue
leaf
Data Source
genbankRelease 135, Apr 15 2003
Title
Barley DNA for waxy locus encoding starch synthase (EC 2.4.1.11).
Strain
Vogelsanger Gold
Clone
lambda wx2
Probe
HVM4
HvWaxy4a
HVWAXYG
Gene
wax (Hordeum)
Gene Class
Starch synthase
Gene Product
starch synthase
Remark
DB_xref: taxon:112509
Feature: source: mol_type = 'genomic DNA'; map = 'chromosome 1'; cell_line = 'Vogelsanger Gold 519/15';
Locus Comment: The sequence overlaps with the cDNA clone wx27, x07932, from bp; 4265 to bp 4647.
Reference
ReferenceRohde W et al. (1988) Structural analysis of the waxy locus from Hordeum vulgare. Nucleic Acids Research 16:7185-7186.
Allele
Wax (Hordeum)
wax (Hordeum)
EMBL Feature
TATA_signal764769Location: 764..769
[ Show all 26 ]
DNA
aaactgtccgactagctgacctcactgtcacagcagctcatttccatgcg
ccagtttggcagcacgtacgtacatcacgcactccacacccacacacaca
gagccgtgaagcagcaaagacgaaaacaaataaaaggaggtggtagacac
caactggcgccccggccggcaatgcactgtcgtcgtccgtcgtcgtgcgg
gcaaaagctctgctagcctcgcacccacaccacgccacgctcctcgtggc
gcgccaccgccaaaaagcgaagaggaaggagcatgccccccatgacggaa
agcaagctagagcgcacgcacgggccatgtccggcgtcgagaaggcgcgg
catgtgggcatcacgcgagagagagagagggcaccggcagtacgtacacc
caccggaaacggaggagacggccggacacgacacgatgatgcgtgcgtgc
acgcgcggcaaggcgaggccggatcgatcggccgctggaaagcgcggcgg
gcggccttcatcttcctcctgtcctgtgtgccaccccatgcacgcagaaa
cgaacaaacagacgacaagcggagaaggcatgcagcagcgtgagtagtat
cgcagacgctcactcaacgtcgatcgcctgcatgctgcctctcgcacggt
cgcagccggtcccgtgccgtggcgcctgcatgcatgcatgcatacatgca
cgagggcgggcggagcgggtattggggatcgggcaccacgggactgagcg
agcgagtacataacatataggcccgctccccggagccacgcaccgttcgt
tcgtttccttggagtcccgtcacttccgcccgcccgccccctaccacaca
ctacaacctctgccactcaacaacaacaacactcactcacgagtgccccg
cgactgtgagcacgcgcgccgcccgcccgtccgtccgtccagagagagga
agaagaagttcaggaagaagaagagatcagatcgatcaggtacgcatgtt
cccatgaccggccagttcccggccggcagccggccgatggatacatcaga
tcggtttattagttcggcaccactcggttggttctactactagatccatg
catatccgtgtggcgcccctgtgagatccactgtcccttgtttttcgact
tccgtgcgtgcaactgactatccatggatctttcttatacattcatggat
ccaaatcctgcatgtactatgatggattcctctgcaaacgatcttagatt
tcaggaacagatccaacgtacggcttccatgcatggttcccgattcatta
aggcttgacacagggaacatactaagaaaattcgtgcttgatgttttctt
tttctaagaaaagggacgtaatataagtttcgtctcatttaataattaag
aagaagagaatttcccgtttaatgaacggaaagccggacaaaaccgtgta
cttatgtttggatttccgaagaaatgtaaagtcgacaaaacctgactgaa
aaattctggagtatttacttcactactcacactgacgatcacgtccagtc
gtctctcactgcaggtagccacaccctgtgcgcggcgccatggcggctct
ggccacgtcccagctcgccacctccggcaccgtcctcggcgtcaccgaca
gattccggcgtccaggttttcagggcctcaggccccggaacccggcggat
gcggcgcttggtatgaggactatcggagcaagcgccgccccgaagcaaag
ccggaaagcgcaccgcgggagccggcggtgcctctccgtggtggtgagcg
ccacgggcagcggcatgaacctcgtgttcgtcggcgccgagatggcgccc
tggagcaagaccggcggccttggcgatgtcctcggcggcctccccccggc
catggccgtaagctagcatcacgacaacccaaccaccattctcttctact
acttgtagcaatgcctgccattacaactgacggcgtgtctgttcaggcca
acggtcaccgggtgatggtcgtctccccgcgctacgatcagtacaaggac
gcctgggacaccagcgtcatctccgaggtaggtatccgccatatgaatga
tcacgcttcacatgctcctgcacatttctgcaagattctaccgactggct
ggatttcgcagatcaaggtcgctgacgagtacgagagggtgaggttcttc
cactgctacaagcgcggagtggaccgcgtgttcatcgaccacccgtggtt
cctggagaaggtgcgtgaccgattctcgtcgtcgatcgatcgatcaagct
atctctttgtcctacaaattccaaactcaaaggtgcatggtgattgatgt
cagtgaatctttgtttctgctgcttacaatttctaggtccggggcaagac
caaggagaagatctacgggcccgacgccggcacagactatgaggacaacc
agcagcgcttcagccttctctgccaggcagcactcgaggcacccaggatc
ctcaacctcaacaacaacccctacttttctggtccctacggtaagattaa
ccacacctcctacctcaaactagactgcaatgtgcactctgaacaagttg
aaatcttcttgagagcaacggatgatcaccatttttcttgtatcttggtg
ccgccgccccgtgtcgtgccgtgcaggggaagacgtggtgttcgtgtgca
acgactggcacacgggccttctggcctgctacctcaagagcaactaccag
tccaatggcatctacaggacggccaaggttttgaaatttgcatcttttga
atctacatattctctctgcatatatatatatatatattgttgtccattct
gaacttacccctggaaccatctgcttttgctaggtggccttctgcatcca
caacatctcgtaccagggccgcttctccttcgacgactttgcgcagctca
acctgcccgacaggttcaagtcgtccttcgacttcattgacggctacgac
aagcccgtggaggggcgcaagatcaactggatgaaggccgggatcctgca
ggccgacaaggtgctgacggtgagcccctactacgctgaggagctcatct
ctggcgaagccaggggctgcgagctcgacaacatcatgcgcctcacgggg
atcaccggaatcgtcaacggcatggacgtcagtgagtgggaccccaccaa
ggacaagttcctcgccgtcaactacgacatcaccaccgtgagcacccacc
cacccacacaaaggatttcctcctcttcttccggtgatcgctggttctgg
gttctctgactaacgaggcaaagtgacaggcgttggaggccaaggcgctg
aacaaggaggcgctgcaggccgaggtggggctgccggtggacaggaaggt
gccgctggtggccttcatcggcaggctggaggagcagaagggccccgacg
tgatgatcgccgccatcccggagatcctgaaggaggaggacgtccagatc
attctccttgtacgtcgaccgacatcgctgatccgcacaaaaaggtctcc
tgatagctccccgtgaggatggatggatgattgagtgatcggatgaattg
cagggcaccgggaagaagaagtttgagaagctgctcaagagcatggagga
gaagttcccgggcaaggtgagggccgtggtcaggttcaacgcgccgctag
ctcaccagatgatggccggcgccgacttgctcgctgtcaccagccgcttc
gagccctgcggcctcatccagctccagggaatgcgctatggaacggtaaa
cgcctcacccttcttgccagcaactcacctcatttgcatatccatggcca
tgaccgaagtttcttccaaattttaagccgtgcgtgtgcgcgtccaccgg
cgggctcgtcgacacgatcgtggagggcaagaccgggttccacatgggcc
gcctcagcgtcgacgtatgctcatcgatcctcttatgtaaattcattcat
cttgttcatcctggctgctcgattagaccatgaaacggtttcctttcttc
ttggtggccagtgcaacgtggtggagccggcggacgtgaagaaggtggcg
accaccctgaagcgggccgtcaaggtcgtcggcacgccggcgtaccagga
gatggtcaagaactgcatgatccaggatctctcctggaaggtacataatt
attttgggtttcacgcagcaatttaaagactgcatggctcaatggtggtc
tgggcgtatgctgcagggacctgccaagaactgggaggacgtgcttctgg
aactgggggtggaggggagcgagccggggatcgtcggcgaggagatcgcg
ccgctcgccatggagaacgtcgccgctccctgaagagagagaaaaaggaa
cattctggtgcatggagcatcttccatcttcagggttctcgtatggggag
atagccgcttgttgtagtgaagggccgatatatatagactaataagtact
taagttttgttgtgccgcttgcctctttacaaaccaaaaaaaaaaagtta
ggggttgtgcttgtgacaaagtgtgtatttcattttgctgtgggtatatt
gcaaataagccaaggatttgttatgtgtttttgctattgtttcaaagtct
ttgtgtttgattccattttgagttattttgtgggttccaaaggaaaggat
cagggttcatcgggacatgaccttgcatttttttgtgttcatcatcgagg
tggcaccttcggtcgcaggaacagaggtgttcaaggcagtccgaactgct
cgccgcctgcagtggaaccaccaccataaagttcgccattttgcatgaag
gaatactcatatatgtgtaagtttcaaaatggcggtgcaacgaccgccaa
gatcgatgcaacataacaaaatgaaaaaaggggagcgatcatctcccgtg
atgaggatagggacagccacctgtgaccataggcgacaacgtgatctgga
tgatatgaacaaagatggtgggaggcacgggagattgtcctaaaaacttt
actatttccatggcttgaaatcaacaatatttcttactcagtttgctgtt
gaactgtgagtctgcgaggcactaaacttacttaataagttgtgcaacaa
ctc

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.