Query (optional)   in Class  

GrainGenes Sequence Report: X07932

[Submit comment/correction]

Sequence
X07932
Subsequence
X07932_1.cds2262037
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC192126
NCBI UniGene
Hv.646
Data at Gramene
Gramene-Protein P09842
DB Remark
Locus Source: Hordeum vulgare subsp. vulgare
UniGene title 'Granule bound starch synthase I'
Keyword
starch synthase
waxy locus
Species
Hordeum vulgare subsp. vulgare
Clone Library
EMBL4
Data Source
genbankRelease 135, Apr 15 2003
Title
Barley mRNA pcwx27 for waxy locus.
Strain
Vogelsanger Gold
Clone
pcwx27
Gene
wax (Hordeum)
Gene Class
Starch synthase
Remark
DB_xref: taxon:112509
Feature: source: mol_type = 'mRNA'; map = 'chromosome 1';
Locus Comment: The sequence overlaps with the genomic sequence of the waxy locus,; x07931, from bp 1918 to bp 2301.
Reference
ReferenceRohde W et al. (1988) Structural analysis of the waxy locus from Hordeum vulgare. Nucleic Acids Research 16:7185-7186.
Allele
Wax (Hordeum)
wax (Hordeum)
EMBL Feature
polyA_site22762276poly A site (pcwx4)Location: 2276
polyA_site22832283poly A site (pcwx27)Location: 2283
polyA_site23012301poly A site (pcwx18)Location: 2301
DNA
gaattccagtcccgtcacttccgcccgcccgccccctaccacacactaca
acctctgccactcaacaacaacaacactcactcacgagtgccccgcgact
gtgagcacgcgcgccgcccgcccgtccgtccgtccagagagaggaagaag
aagttcaggaagaagaagagatcagatcgatcagtcgtctctcactgcag
gtagccacaccctgtgcgcggcgccatggcggctctggccacgtcccagc
tcgccacctccggcaccgtcctcggcgtcaccgacagattccggcgtcca
ggttttcagggcctcaggccccggaacccggcggatgcggcgcttggtat
gaggactatcggagcaagcgccgccccgaagcaaagccggaaagcgcacc
gcgggagccggcggtgcctctccgtggtggtgagcgccacgggcagcggc
atgaacctcgtgttcgtcggcgccgagatggcgccctggagcaagaccgg
cggccttggcgatgtcctcggcggcctccccccggccatggccgccaacg
gtcaccgggtgatggtcgtctccccgcgctacgatcagtacaaggacgcc
tgggacaccagcgtcatctccgagatcaaggtcgctgacgagtacgagag
ggtgaggttcttccactgctacaagcgcggagtggaccgcgtgttcatcg
accacccgtggttcctggagaaggtccggggcaagaccaaggagaagatc
tacgggcccgacgccggcacagactatgaggacaaccagcagcgcttcag
ccttctctgccaggcagcactcgaggcacccaggatcctcaacctcaaca
acaacccctacttttctggtccctacggggaagacgtggtgttcgtgtgc
aacgactggcacacgggccttctggcctgctacctcaagagcaactacca
gtccaatggcatctacaggacggccaaggtggccttctgcatccacaaca
tctcgtaccagggccgcttctccttcgacgactttgcgcagctcaacctg
cccgacaggttcaagtcgtccttcgacttcattgacggctacgacaagcc
cgtggaggggcgcaagatcaactggatgaaggccgggatcctgcaggccg
acaaggtgctgacggtgagcccctactacgctgaggagctcatctctggc
gaagccaggggctgcgagctcgacaacatcatgcgcctcacggggatcac
cggaatcgtcaacggcatggacgtcagtgagtgggaccccaccaaggaca
agttcctcgccgtcaactacgacatcaccaccgcgttggaggccaaggcg
ctgaacaaggaggcgctgcaggccgaggtggggctgccggtggacaggaa
ggtgccgctggtggccttcatcggcaggctggaggagcagaagggccccg
acgtgatgatcgccgccatcccggagatcctgaaggaggaggacgtccag
atcattctccttggcaccgggaagaagaagtttgagaagctgctcaagag
catggaggagaagttcccgggcaaggtgagggccgtggtcaggttcaacg
cgccgctagctcaccagatgatggccggcgccgacttgctcgctgtcacc
agccgcttcgagccctgcggcctcatccagctccagggaatgcgctatgg
aacgccgtgcgtgtgcgcgtccaccggcgggctcgtcgacacgatcgtgg
agggcaagaccgggttccacatgggccgcctcagcgtcgactgcaacgtg
gtggagccggcggacgtgaagaaggtggcgaccaccctgaagcgggccgt
caaggtcgtcggcacgccggcgtaccaggagatggtcaagaactgcatga
tccaggatctctcctggaagggacctgccaagaactgggaggacgtgctt
ctggaactgggggtggaggggagcgagccggggatcgtcggcgaggagat
cgcgccgctcgccatggagaacgtcgccgctccctgaagagagagaaaaa
ggaacattctggtgcatggagcatcttccatcttcagggttctcgtatgg
ggagatagccgcttgttgtagtgaagggccgatatatatagactaataag
tacttaagttttgttgtgccgcttgcctctttacaaaccaaaaaaaaaaa
gttaggggttgtgcttgtgacaaagtgtgtatttcattttgctgtgggta
tattgcaaataagccaaggatttgttatgtgtttttgctattgtttcaaa
gaaaaaaaaaa

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.