Query (optional)   in Class  

GrainGenes Sequence Report: X57845

[ Printable Version ]  [ Submit comment/correction ]

Sequence
X57845
Subsequence
X57845_1.cds26867058
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC153893
Data at Gramene
Gramene-Protein P27967
DB Remark
Locus Source: Hordeum vulgare subsp. vulgare
Keyword
nitrate reductase
Species
Hordeum vulgare subsp. vulgare
Cultivar
Himalaya
Chromosome
6 short arm
Developmental Stage
seedling
Data Source
genbankRelease 145, Dec 15 2004
genbankRelease 135, Apr 15 2003
Title
H.vulgare gene for nitrate reductase.
Strain
vulgare
Clone
pMJ7-8
Probe
HVGNIRE
bNRp30
Gene Class
Nitrate reductase
Remark
DB_xref: taxon:112509
Feature: mRNA: note = 'nitrate reductase'
Feature: mRNA: note = 'nitrate reductase'
Feature: source: mol_type = 'genomic DNA';
Feature: source: mol_type = 'genomic DNA'
EMBL Feature
TATA_signal25432550Location: 2543..2550
exon257638561Location: 2576..3856
exon548272402Location: 5482..7240
intron385754811Location: 3857..5481
DNA
ggatccaatatgggcatccaggtcccgctattggatattgaccgaggagt
cactccggtcatgtctacatagttctcgaacccggcagggtctgcacact
taaggttcgacgttgttttatgcgtatttgagttatatggttggttaccg
aatgttgttcggagtcccggatgagatcacagacgtcacgaggggtatcc
agaatggtccggaaacgaagattgatatataggatgacctcatttgatta
ccggaaggttttcggagttaccgggaatgtaccgggaatgtaccgggaat
gacgaatggtatccgggtgttcaccggggggaggggcaacccaccccggg
aatcccataggccttgggggtggcgcaccagcccttggtgggctggtggg
acagcccaaaagggccctatgcgccaaggatagaaaatcaaagagaaaga
aaaaaaaaggaggtgggaaaggagagaaggactccacccaatcctagttg
gactaggattggaggaggactcctcctcccttggtggcgcagcccttggg
gaactccttgagcctcaaggcaagcctgcctccctcctcctatatatatg
gagcaattagggctgatttgagacaactttttcaaaggcagcccgaccac
atacctccacggttttacctctagatcgcgtttctgcagagctcggcgga
gccctgccgagataagatcatcaccaacctccggagcgccgtcacgctgc
cggagaactcatctacctctcctcgtctcttgctggatcaagaaggccga
gatcatcgtcgagctgtacgtgtgctgaacgcggaggtgccgtccgttcg
gcactatacgtgggacggatcgcgggacggttcgtgggacggttcgcggg
gcggatcgagggacgtgaggaacgtttcactacatcaaccgcttcactaa
acgcttcgtgctgtcgatctacaagggtacgtagatcggaaatcccctct
cgtagatgaacatcaccacgacaggttttcgtggcggcgtaggaaatttt
ttttttgtttcccatgcgacgttctccagcattttcttcttactgtgttg
cttattatgggtgtttctaatggtagttgatgaagtagacgaagtgctcg
atgttggactagaagctcgtgaagaccttgaagactttgctgaaccactc
aagcagccgcttgaccatgacttgaaaccattttatgcatgtcatatggc
actttacttcgttgcatttgaatcatgttgaatcggtggacaccttggtg
ggttgtctccgataacacctcgttaatacttgtactgagcatgaccctat
cttctctgttaaacctaggaaactctatgtgcgacctccattctagtact
tccgtccatgctcgctaccctccccagggcacatgcagatttatccaccg
ttgggcatggaaccggagtataggagagcaactcaaagttatcggttgta
ttagagagttgcaacaacaacagggtagataagtgctcgatccctgtgtg
tgtgtgtcggggggggggggggccagggtcattgtcaaccaagttcgagg
tctatgttggtggcgctgcagatctcgatgatgtgcatgaccaaatcctc
caagggacggtcgaccatgcttgggcctaggggagtccaaaagcatcatc
ccattatggccaccaccgttgtcgacaaggacaaccaatgtttatcaaaa
tgtcgatggggctccatatatacatctatgtgttttttccataggttcga
accggttggagtgggacatttgccgccaaacgacctctgcctggcatggc
tctcatcaatggtgacacatgttcaatccatacagggttagggatggttt
gaacatggatggcacacttgttgcactttaaggacctgcatgttggcttc
caaaaggccgagaacatacgtgagtcctctagaatagttgaaggacctaa
tatgcacttcaacactatgagtcgcagggctgggcccgtagatatgctaa
ctgtgcagcccgcatagggccaataaatttgttgagccggaagggggggg
ggggtgtactaccaatcggaacggaatcgggatggtttctggaatctaga
cgcttagcgatgagggggaagaggacggggcggcagagcaagcggtacat
gatagtgccaccaattgaggttgggggggagaggttgagttcacaataat
ggtgctaattcaatacataagtcgatgaagacggcaaaatggaggggggc
ctgggggctgggggacgggtgcgtatgttcggcatatcagttggcgatgc
tctaagattgttattattatttttaaagaaaacatcgtttttctgatttt
gactgactcgatcttgggcgtgcacaaggaagcaaacagagagatatgga
gacgagtcgacataaggatagggctgctaccggccttttgagccgcaccg
tcactccactcgggaggtcggcgttgcgtccttgcgtgtgtgtatatata
cctgcatccacaccgcttctcttttcaccaggccaccccgtgccgccggt
tcctttcctttcatttcctcatccgccgcgaccagtccagaaccggtcca
acactagcttgtcccacacacaaacgcaccacgccatggccgcttcggtc
gagccacggcagccgttcggccgcctcgacgcgccggccaccgctccaac
tgctcgtgcccccggctcgaacggcatccgtcgccgcgccgactccccgg
tgcgcggctgcgggttcccctcgctcatttcgccgccacggaaggggccc
gtggcggaggaggaggaggacgacgacgatgaggatgacgaggggcatga
ggactggagggaggcgtacgggtcgcacctgcagctggaggtggagccgt
cgacgcgcgacccgcgcgacgagggcacggccgacgcctggatcgagcgc
aacccgtctctgatccggctcaccggcaagcacccgctcaactgcgagcc
tccgctggcccggctgatgcaccacggcttcatcaccccggcgccgctcc
actacgtccgcaaccacggcgccgtgccccgcggcgactgggccacctgg
acggtggaggtgactggcctcgtccgccgccccgcgcgtctcaccatgga
cgagcttgccaacggtttccccgcggccgaggtgccggccacgctcgtct
gcgccggcaaccggcgcaaggagcagaacatggtgcagcagacggtgggt
ttcaactggggcgcggcgggggtgtccacctccgtgtggcgcggcgcgcg
gctccgcgacgtgctgctccggtgcggcgtcatgtcgaaaaaggggcagg
ccctgaacgtgtgcttcgagggcgccgaggacctccccggcggcggcggc
tccaagtacggcacgagcgtgagccgggagtgggcgatggacccgtcacg
cgacatcatcctgccctacgcgcagaacggggagccgctgctgccggacc
acggctacccggtgcgcgtcctcatcccgggatgcatcggcggccggatg
gtcaagtgggtgcggcggatcgtggtcaccaccgccgagtccgacaacta
ctaccacttcaaggacaaccgggtgctgccgtcccacgtcgacgccgagc
tcgccaacgccgaggcatggtggtaccgcccagagtacatcatcaacgag
ctcaacaccaactgcgtcatcaccaccccggggcacgacgagatactacc
catcaacgccttcaccacacagcgcgcatacaccatcaagggatacgcat
actcaggtacgtcgtcgtcctcctcctccatccatccatccgtttcattt
ttttttttattatacgttcttttttttattttagagaggaaaaaggtcag
aacgccaaggatgacgcgatataagagccagcatatgatatacttgcttc
cgtagcattgaccataagactcgattagtatataccacaccttgtgtgtt
aggaacgcaaaggagaagaaaactcaacttaatgagaggacgttgaccaa
gccaatatagatcacacacaatgcatttgttagatgattgacattggcat
gtagcgttgaaaaattgggcatgcttgagtgagacagtccccttattttc
tactgctaacagttgacggtggcagccactcattgtacgttttattactt
attttattactcctaacataacactagtagttgcgtcgcgtggctccaaa
accttcatctgcgcaaggaaagcgtatagataaaacccatgcatcgcatt
ttttctttctttctgccaaggaaagcgtatgataaaaccccatgcatatg
catgcatgcacttttctgtggctctggggtcgttggcacttggtgacccc
caaaagctatgtaggctgactgtagctgccggactggatgcatgccatgc
catgccatgccatgccatgccatggagtataaacagcaagaagaacgttg
ctagctagctctagctcttggaatagtcagctggacaacacagggctcgg
ccatggcaagctcgtacctggtgcagtgtcgggctctgagaacaaaggac
aaactatagtagatgcccatatgattggacaccatccagaattcattcgt
gtgtgtggccaaccgcagccagaagcctgatttttctcctatctagcagt
actagatcaacagtaactctactagtagtacacctgttggtttcaacgat
agtgcatgcttccttccttgttaggttcacacgtgctcatactacacaca
cgtaacgtacagtgcaacagctaaacgtatccgctttacgaataaagcct
tcgacaggggtagtattgtgcacaagaaaaggtcgaagaaaaggtccaac
aaaagacacaagagagggactaagtctgaaaaaggtaaactaaagcatcg
ggcacttgttgccaagtcaaaagcaactgaagaaagcatgcacttcctcc
ccagccaatcgtcagcgagtggaatcggaatcttagcatcaacatgtgat
aagtgatgtactctactgatattccaacttgggcataagagagcgtgtca
aatgtgaatacggtcgcttgcttgcttgctgacacaagcttttttggttt
agtcggaaaacgatgtgtcattagctcacactgcagtaattaactaggga
ttggcttcatgggagtcgtctggaaaagtcaaaagcaagcaagtatgcga
ctgaagaaagccccgcataccctttcttgtcttttctaaaataagagaac
acaaactgtttgtatgagttctctcttcttcaccgcattgatttatccta
cgtgacactcctaacattcaacaatagctatcgagtcaccaagtcatgat
cttttttcttcttcgttgttgtggtttgtaggcggtggcaagaagatcac
acgagtggaggtgacgctggacggcggcgagagctggatgctgtgcacgc
tcgacatcccggagaagcccaacaagtacggccggtactggtgctggtgc
ttctggtcggtggagatcgaggtgctggacctgctgggcgccaaggaggt
ggcggtgcgcacgtgggatcagacccacaacacccagccggagaagctca
tctggaacctcatgggcatgatgaacaactgctggttcaagatcaaggtc
aacgtgtgccgcccccacaagggcgagatcgggctggtgttcgagcaccc
cacgcagcccgggaaccagaccggcggatggatggcgcgccagaagcacc
tcgagacggcggaggcggcggcgccgggcctcaagcggagcacgtccacg
ccgttcatgaacaccgccggggacaagcagttcaccatgtccgaggtgcg
caagcacgggtccaaggagtcggcgtggatcgtggtgcacggccacgtct
acgactgcaccgccttcctcaaggaccaccccggcggcgccgacagcatc
cttattaacgcaggatccgactgcaccgaggagttcgacgccatccactc
cgacaaggccaaggcgctgctcgacacctaccgcatcggcgagctgatca
ccacggggacggggtacaactccgacaactcggtgcatggagggtccagc
ctatcccacctcgcaccgatccgcgaggccaccaaggtcgccggcgcgcc
catcgcgctctccagcccacgcgagaaggtcccgtgccgcctcgtcgaca
agaaggagctctcccacgacgtccgcctcttccgcttcgcgctgccgtcc
tccgaccaggtgctcggcctccccgtcggcaagcacatcttcgtttgcgc
caccatcgacggcaagctctgcatgcgcgcctacacgccgacgagcatgg
tggacgagatcgggcagttcgagctgctcgtcaaggtctacttcagggac
gagcacccgaagttccccaacggcgggctcatgacgcagtacctggagtc
gctccaggttggctcttcctacattgacgtcaagggcccgcttgggcatg
tggagtacaccggccgtggcaacttcgtcatcaacggcaagcagcgccgg
gcgcggcggctggccatgatctgcggcggcagcgggatcacgcccatgta
ccaggtgatccaggccgtgctgcgggaccagccggaggacgagacggaga
tgcacctggtctatgccaaccggagcgaggacgacatcctgctgcgcgac
gagctggaccggtgggcggcggagtaccccgacaggctcaaggtgtggta
cgtgatcgaccaggtgaagcggccggaggacgggtggaagttcagcgtcg
ggtttgtgacggaggacatcctccgggcgcacgtccccgagggcggcgac
gacacgctcgcactcgcctgcgggccgccgcccatgatcaagttcgccat
ctcccccaacctggagaagatgaagtacgacatggccaattccttcatct
ccttctgatcggtgaaacatttctcctctctagtagtacctactcatagg
tagcatggagctacctaagctatatacacctacgcgtcgacgcatcaacc
tgtggatgtacccaatgtttatacgtgttgtgtttgttcattagagaacc
gtacgtacgtgcatgaatatgattgcatgaattatactgtacgtgcatta
actatatagccatgcatgttttgccctcaggaaggatgtgaagtctaca
BLAST
BLAST Search