Query (optional)   in Class  

GrainGenes Sequence Report: X60173

[ Printable Version ]  [ Submit comment/correction ]

Sequence
X60173
Subsequence
X60173_1.cds4463415
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC167277
Data at Gramene
Gramene-Protein P27968
DB Remark
Locus Source: Hordeum vulgare subsp. vulgare
Keyword
NAD(P)H-bispecific nitrate reductase
nar7 gene
Species
Hordeum vulgare subsp. vulgare
Cultivar
Himalaya
Chromosome
6, long arm
Clone Library
Barley genomic (lambda)
Data Source
genbankRelease 145, Dec 15 2004
genbankRelease 135, Apr 15 2003
Title
Hordeum vulgare nar7 gene for NAD(P)H-bispecific nitrate reductase.
Strain
vulgare
Himalaya
Clone
pMJ4.1 (subclone in pBluescript)
Probe
pMJ4.1
Remark
DB_xref: taxon:112509
[ Show all 8 ]
EMBL Feature
CAAT_signal251256Location: 251..256
[ Show all 8 ]
DNA
aactactagctaccaagcgacgtcacgggccgtgaacaggcgtttgttcg
gagtacggatgaggaaaagaaatggcccatgcaagacccagaggagatcc
tggctgcgtttcgtcgtgtggtgacgtcgtcaacaactcgtgttgattga
tgggttacttactatagatgcaccgagtgcgcgtgcatgcaccagcaccg
gcaatgcatggcagtttggcaccacatgtgaagtgtttttatttccctgg
caatttggcaccacgcaaaacgccgtgccacgctcgaacggagcacgact
cgacagctccaccgtctccgtccctatataagccgcgcgccaccactcca
cggcttccaagagcgcgccgccagccatcctgagcttctgagcttgtgtt
ccagcttccagcacgccgatcccgagacacccgtgctagctaacaatggc
ggcctccgtcgagtacaaccgtcaggtgtccgcccacccgtggccgacca
atgcgcagcccaaggccgccttcgacctcttctcctcctccggcggcggc
aggcgccgttcgggcgcggactccgactcggacgacgaggacagcgttcc
gccggactggcggtcgctctacagcccgcggctcgacgtggagccatcgg
tcaaggacccccgcgacgaggccacctccgacgcctgggtcaagcgccac
ccggcgctcgtccgcctcaccggcaagcacccgttcaactccgagccccc
gctgccgcggctcatgtcccacggcttcatcaccccggtcccgctccact
acgtgcgcaaccacggcgccgtgcccaaggccgactggtccacctggacc
gtcgaggtcaccggcctcgtcaagcgcccggtcaagttcaccatggagga
gctcgtcacggggttccaggccgtggagttcccggtcacgctggtgtgcg
ccggcaaccggcgcaaggagcagaacatggtgcgccagtcctcgggcttc
aactggggtcccggggccatctccaccaccgtgtggcgcggggtgcgcct
ccgcgacgtgctgcgccggtgcggcgtcatgggggccggcgccgcctcca
acgtgtgcttcgagggcgccgaggaccttcccggcggcggcgggtgcaag
tacggcaccagcctccggcggtccgtggccatggacccggcccgcgacgt
catcctcgcctacatgcagaacggcgagccgctggcgcccgaccacggat
tccccgtgcgcgtcatcgtgccgggcttcatcggcggccgcatggtcaag
tggctcaagcgcatcgtcgtggcctgcaacgagtcggagagctactacca
ctaccgcgacaaccgcgtgctgccgtcacacgtcgacgccgagctcgcca
atgccgaaggtacttccgatttgccttctctcctaggctagcgtatgcag
tgcacgtcgcgtgcatgccgacagggcacatgacgacggcgagccttacg
gtgtcttgtttgtctggatgttttcagcttggtggtacaagccggagtgc
atgatcaacgagctcaacatcaactcggtgatcaccacgcccggacacga
cgaggtgctgcccatcaacgcgctgacgacgcagaagccgtatacgatga
agggatatgcctactccggtgagtccgccctcccacccacatctcatgtc
cggcgtcacatcacatcatctctgtcggaaatagttttcggcttgggacg
gctcgttagtcgttacacaagcccaggttccagcctgtttttctgggcct
ggatacgactattctaaacacagcggtgctgtttcttttatcaggcggtg
gccggaaagttacgcgggtggaggtgaccctcgacggcggcgagacgtgg
caggtgtgcgatctggagcacccggagcgtcctaccaagtacggcaagta
ctggtgctggtgcttctggtcggtggaagtggaggtgctggagctcctgg
gcgccaaggagatggccgtccgcgcgtgggacgaggccctcaacacccag
ccggagcgcctcatctggaacctcatgggcatgatgaacaactgctggtt
ccgggtcaagatcaacgtctgccgcccccacaagggcgagatcggcctcg
tcttcgaccacccaacgcagccgggcaaccagtccggcggctggatggcg
cgccagaagcacatcgagacgtccgagaccacgcagggcacgctcaagcg
gagcacctccacgcccttcatgtccaccgcctcagcccagttcaccatgt
ccgaggtgcgccgccacgcctccaaggactccgcctggatcgtcgtgcac
ggccacgtctacgactgcaccgccttcctcaaggaccaccccggcggcgc
cgacagcatcctcatcaacgccggctccgactgcaccgaggagttcgacg
ccatccactccgccaaggcccgcggactcctcgagatgtaccgcgtcggc
gagctcatcgtcaccggcaacgactactcgccgcagagcagcaacgccga
cctcgcggccatcgtcgaggcccccgctgtcgtcgtgcctcggctgccgg
cctccgccgtcgcgctcgccaacccgcgggagaaggtgcggtgccggctc
gtcgacaagaagagcatgtcccacaacgtgcgcctgttcaggttcgcgct
gccgtcgcctgaccagaagctcgggctgcccgtcggcaagcacgtgtacg
tttgcgcgtccaccggcggcaagctctgcatgcgcgcgtacacgccgacc
agctccgtcgaggaggttggccacgtggagctgctcatcaagatatactt
caaggacgaggatcccaagttccccgccggcgggctcatgtcgcagtacc
tcgacgcgctgccgctcggtgcccccgtcgacatcaagggccccgtgggc
cacatcgagtacgccggccgcggcgccttcacggtgggcggcgagcgccg
gttcgcgcgccggctcgccatggttgccggcgggacggggatcacgccgg
tgtaccaggtgatccaggccgtgctgagggaccagcccgatgacaccacg
gagatgcacctggtgtacgcgaaccgcacggaggacgacatgctgctgcg
ggaggagatcgaccggtgggcggccgcgaacccggcgcggctcaaggtgt
ggtacgtggtgagcaaggtgggtcggccggaggacgcgtgggaatacggc
gtggggagagtggacgagcaggtgctcagggagcacctgcctctgggcgg
cgacggcgagacgctcgcgctcgtctgtgggcctccggcgatgctcgagt
gcacggtgcgcccgggactggagaagatggggtacgacctcgacaaggat
tgcctcgtcttctaagcagaggccgccgtgcacgataatacgtagtacta
cttggttgtacatagcgtagtagacctacgtacgtagttgcatgatcctg
caacttattagcatagaaaagtgcgggagtcggaattc
BLAST
BLAST Search