Query (optional)   in Class  

GrainGenes Sequence Report: X64101

[ Printable Version ]  [ Submit comment/correction ]

Sequence
X64101
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Secale cereale (rye)
Keyword
dispersed repeat sequence
R173 family
retrotransposon-like
Species
Secale cereale
Chromosome
1 (short arm)
Clone Library
lambda EMBL3
Data Source
genbankRelease 135, Apr 15 2003
genbankDownloaded 2008-2009
Title
S.cereale DNA for dispersed repeat sequence (R173-2).
Strain
Chinese Spring 1BL/1RS, 1AL/1RS, 1DL/1RS triple transloction from Rye
Probe
R173-2
Remark
DB_xref: taxon:4550
Feature: source: mol_type = 'genomic DNA';
Locus Comment: See also X64100-3.
DNA
ggatccaacctcagcctattcaaagggaatctcgcaccagctagtgtttc
acaaccagtatctttggataacgaagaatggcggaccatttcgttgtata
tcttcaacaacctgatagaagtgcggccgtacatcgagtaagttctcggt
acattgtttcgcaacttctatttcctttgaactactcttattcctggata
tgtcatacagtcgatacgttaccatattctcgtatggagcggagatcaat
tactgcctgctgttctgtttttcacagattctgtcctgttttgccttacc
ttcactttgcaaattaagaacttgctttttctttgcaaaaaccttttggc
aatcttgagaaacagtagaacttcaagaatatccttatttacagcaagat
ataattattttattaagggtactaacctcgctaatcagattatgatgagt
tatgtatgaagggagttttcaagtgtgcgagggaagatgataaaaagatt
caggagtgtcaagcgctcaagcttggggatgcccccatgcacccccaaga
aatattcaaggagactcaagcgtctaagcttgggtatgcccccgtgcatc
cccttctccatcaacattatcagttcgtctttcgtttcgctatattttta
tcacttcatgtgttatgtgctatgcttggagcgtcttgcttctagttttc
tttttagtttttcataacgagtcggaactcagcattcctttatgtgggag
agaaacacgctccacttctacctagaacataacatagaattttcatgtct
atctatgctgtgtgtgttctttgtcttttaatagctactgtcgtgctctg
ctcttagtattcatgcttatcttttcaagagcttttatttagttggttgc
ttgaactctctttaattaccatgctcaccttattaagagagtttgcttcc
gttgcatgggttaatgtgtctatgataaagatgctactttcatgatggtg
cttagtagttcaggttttcttttggttaatctcaaatagctggggggttc
ccaatgtgttattggagtaccaacttgatttgtttgcctatgatgtggta
tggtttagtaatatcttccttcgagaatttattttgattgacttggcgta
tgctcacgcatattcaagactgtaaagaaagtctgtcaagccttgatgat
cttttatttctgagtagcgatataactaccatgcctgattcaatattgct
ttgtcgctctgcatgattatgaccgtcattgctctcttagttggtcgctc
ccagtctttttgctaacctccacctgtactaagcaaactaaccatgcaat
acatagctcatgggaaagtagcctaaaaactattgtggtaaagaatatgt
tgcttatgtatcttatttcttatgagttgcttgctgagcggtaaccatgt
ttctggggacgccatcaactgtcacacttttgttgaatatcatgtgagtt
gctatgcatgttcgtcttgtctgaagcaagggtgatttatcgtgggttga
ataactatgcatattgttagagaagaacattgggtcgccaaccaaagcca
tgcatcatggtggaagttttagcttggaccttaatcctcaatctctcatg
agaatatgcctatgcattaaagaggagtccatcatctattttctatgttg
tcccggtatggatgtcctcaagttgagatctatcaaaaacgagaaatcaa
atgcgatctatctccttggacctttgtacaggtggcatagaggtacccct
ttgtgacacttggttgaaacatatgcaatgcaatgataacccatggaaat
ccgagctaattaggacaaggagcgagcactattggtattcgatgcatgag
gcttgcaacttataggatgttttatacatgacacatacaaagtactacta
ccgttgacacaattgcttccatgttttcaaaataaaaagctttagcactt
aacctttcttttacctttatgttaaagcaccaactactaagagcatgatt
gtcattctgagtgtaatgtgcattgtcccaaagtagcattgtcttttgca
tgattgtgatatcgtttattctgaaatgattgtatctagtcatcacttaa
accttgaaggtgcccctgcatttatgttttgcatcactaaagggggcaag
ctagatatcactttatcatatttgcacatcatgttcattgcaaatctttt
tgatgtttcagtttcatgttgtaaaactttcagtcatttgtgattttctc
ttgagacaacttaattattttagaatcattgtctcagtaagcttttgtca
tatgactatgagaaagtcctatatggttaatagcatgtcaccacagaaat
tattcttgttatcatttacctactcgaggacgagcaggaattaagcttgg
ggatgttgatacgtccaaaacgtatctataatttctgcttgctccatgcc
acttttgggtgatattgctatgatattcatacacttccatacacttttga
tcatatttggactaacttactaatccagtgcaccccagtgccagtttctg
ttttcggctgtttttgtatttcaggttttcacgtttcgagaactgcccag
aaaaatccagaaaaattatataaaaaatcagcgatccgaaaacaacactg
cgtccgaagggcagcgtgggggggggggcacaggggctccatgcgccctg
tggcgcgcccccctgggccgcgccggggggggggggggcgcctgggcccc
ccgaagcccgtccggtgcccccctttggcatatatttagagggacctccg
aaaccctcagaacaggaactcttttcgcgatcccatctctgttccgccgc
cgccgccgcttccaagatcgggagcaccaggagaactcttcccggcaccc
tgccggaggggaggatcaccaccgggagcttctccaccaccatggacgcc
ttccggatgactcgcgagtagtctcccttggaccatgagtccatgaccag
tagctatgtgatgttctcctcccgttcttgtgcttcactaattagtcctc
gtgagctgccctacatgagcgaggcacctatgtaatccttatgctgttgc
tatgttgagtttgctgggatccgatggattatgagattatgttcagattg
atcttgagtaatatatttgattcacctcttttatattttagttcataagt
aattcttgcatgttctccgttgttacttattgctttggccgagtagtagg
tagtgactccaagagggaacgttatgcttgattgtgggttcatgcccctc
gatgactagcttgagtgacagaaacatgagtctaggggatgtgctattgc
cacaagggggaaaacaacggtgcttgtgcccgcgggtgcaaggattgttt
actttacgcaaagttcttttaatgcagttgtctgttgcattgagtttaca
ctatgggtgggactcgcaacttaataccagcgagatgttctggatagata
tctcaaggtggatgattagtagtagatattgatggatttcggtctactta
ctttggcgtaccgcccatgctttgaacctcaacctttcttgcaatgtagt
cagcattggtttgcgttcgtggtcctgtcaattgcccagctgtaatttgt
ttacctcacatagctgttttatcgtcttttgggagagagacatcactagt
gaacatcatgagactccggtccatattaccatcattgttcacatccacta
tttacttttcgctatttacctactattgcaaaaactatatatcactacta
tcattgcttttaaccctttgtgaactacaaggccggagggattgacaacc
tctctgtactcgttgggagcaaagttatttgtatctgtgtgcaggtccac
gttgattgctaattgcgccgttagcagttgacacctacttgttgaaccta
ggagtctctggggattcgatccttgacatctttgctaggggaaaacactt
ctacttactgcatcttacaccttccacttggggtaaccaacgaggggttc
gaggcccatcaatgtactttgtgaaagaccaatgaggcgtcttgatctat
ctctatagattttgatgcctaatatgtaagcagcttctccaaggtccttc
attgaaaaacttttattcaagtaggcctttacattttccaagaattc
BLAST
BLAST Search