Query (optional)   in Class  

GrainGenes Sequence Report: X76737

[ Printable Version ]  [ Submit comment/correction ]

Sequence
X76737
Subsequence
X76737_1.cds351453
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
Data at Gramene
Gramene-Protein O49257
DB Remark
Locus Source: Avena sativa (oat)
Keyword
12S globulin
Species
Avena sativa
Clone Library
cDNA library
Developmental Stage
middle stages
Data Source
genbankRelease 145, Dec 15 2004
genbankRelease 141, Apr 15 2004
genbankDownloaded 2008-2009
Title
A.sativa (L) mRNA for 12S globulin (1556 bp).
Gene
12s globulin
Gene Product
12s globulin
Remark
DB_xref: taxon:4498
Feature: source: mol_type = 'mRNA'; haplotype = '2n';
Feature: source: mol_type = 'mRNA'; haplotype = '2n'
Feature: source: mol_type = 'mRNA'; /haplotype = '2n'
Gene: 12s globulin
EMBL Feature
mat_peptide1061450Location: 106..1450
sig_peptide35106Location: 35..106
feature_gene11556Location: 1..1556
DNA
accattccaccttctacaatcttttcaaacaatcatggcaactactagtt
ttccatcggtattgttttactcttgcatttttctcttatacaatggatcc
atggctcaactattcggacagagctttactccatggcaaagctctcgaca
aggaggtttaaaggggtgcaaatttgataggctgcaagcatttgaaccgc
ttcgacaagtgaggtcacaagcgggtgtcactgagtactttgatgagcag
aatgagcaattacgttgtaccggggtatctgtcattcgtcgtgttattga
gccccaaggcctcttgttacctcaataccacaacgcacccggtctggtgt
accttcttcaaggtaggggtttcacggggttgactttacctggatgtcca
gcggccttccaacaacagttccaaccatttgatcgagcccagggtcaaag
ccaaagccatctcaaagatgagcaccaaagagttcaccgctttaaacaag
gagatgttattgcgctgccagctggcattgtacactggggctacaatgat
ggtgatgctccagttgtagctatctatgtcttcgacgtaaacaacaacgc
taatcaacttgaacctagacaaaaggagttcttgttggctggtaacaata
aggaagatcaacaatttggacaaaacatattcagcggattcaatatccaa
cttcttagtgaggctcttggtataagtcaacaagcagcacagaggatcca
aagtcaaaaggaacaaagaggtgagataattcgtgtgactcaacgccttc
aattcttaaagccaacaatgtcccaacaagacagaagtttcaatggtttg
gaggagaacttttgttcattggaggcaaagcagaacatcgaaaaccccaa
acgtgccgacacgtacaacccacgtgctggtaggataacacgtctccatg
gacagaatttccccatccttaacctcgtgcaaatgagcgccacaagagta
aatctataccagaatgctattctttcaccattctggaacatcaatgcaca
tagtgtggtctacatgattcaagggcatgctcgagttcaagttgtcaata
acaatggtcagactgtattcaatgaccgtcttcgccaaggtcagttgcta
atcttaccacaacactacgttgttctcaagaagacggagcgtgaaggatg
ccagtatatctcattcaagaccaacccaaactccatggttagccacattg
ctggaaagagctccattcttcgtgccttgcccgtgaatgtcctcgccaat
gcataccgcatttccaggcaagaagtccgaaacctcaaaaacaacagggg
acaagagtctggtgtattcactccaaaatttacccaaacgagcttccaac
cttatccagagggcgaggatgagtcatctttgattaataaggcatcagag
taaattagtgagtgtgatgaggaccaatatagtgaaataaaagcatcgca
agtgtggaagtgggtggtatataaccgcttatcttaataaataacttcat
catgtt
BLAST
BLAST Search