Query (optional)   in Class  

GrainGenes Sequence Report: X76738

[ Printable Version ]  [ Submit comment/correction ]

Sequence
X76738
Subsequence
X76738_1.cds351582
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
Data at Gramene
Gramene-Protein O49258
DB Remark
Locus Source: Avena sativa (oat)
Keyword
12S globulin
Species
Avena sativa
Clone Library
cDNA library
Data Source
genbankRelease 145, Dec 15 2004
genbankRelease 141, Apr 15 2004
genbankDownloaded 2008-2009
Title
A.sativa (L) mRNA for 12S globulin (1685 bp).
Clone
A2B
Gene
12s globulin
Gene Product
12s globulin
Remark
DB_xref: taxon:4498
Feature: source: mol_type = 'mRNA'; haplotype = '2n';
Feature: source: mol_type = 'mRNA'; haplotype = '2n'
Feature: source: mol_type = 'mRNA'; /haplotype = '2n'
Gene: 12s globulin
EMBL Feature
mat_peptide1071579Location: 107..1579
sig_peptide35106Location: 35..106
feature_gene11685Location: 1..1685
DNA
accattccaccttctacaatcttttcaaacaatcatggcaactactagtt
ttccatcggtattgttttactcttgcatttttctcttatacaatggatcc
atggctcaactattcggacagagctttactccatggcaaagctctcgaca
aggaggtttaaaggggtgcaaatttgataggctgcaagcatttgaaccgc
ttcgacaagtgaggtcacaagcgggtgtcactgagtactttgatgaacag
aatgagcaatttcgttgtactggtgtattcgtcattcgtcgtgttatcga
gcctcaaggcctcctgttacctcaataccacaatgctcctggattggtgt
acatccttcaaggtaggggatacacagggttgactttcccgggatgccca
gcaaccttccaacaacagttccaaccatttgatcaagcccaggatcaaag
ccaaagccatctcaaagatgagcaccaaagagttcaccgctttaaacaag
gagatgttattgcgctgccagccggcattgtacactggggctacaatgat
ggtgatgctccggttgtagctatctatgtcttcgacgtaaacaacaacgc
taatcaacttgaacctagacaaaaggagttcttgttggctggtaacaata
aggaagatcaacaatttggacaaaacatattcagcggattcaatatccaa
cttcttagtgaggctcttggtataagtcaacaagcagcacagaggatcca
aagtcaaaaggaacaaagaggtgagataattcgtgtgactcaagcgcttc
aattcttgaagccaacaatgtcccaacaagaactagtagagcatcaagcc
taccaaccaattcaaagtcaagaaggacaatcaacccaataccaggtagg
gcaatcaacccaatatcaagaaggacaatcaactcaataccaggcaggac
agtcacaagacagaagtttcaatggtttggaggagaacttttgttcattg
gaggcaaggcagaacatcggaaaccccaaacgtgccgacacgcacaaccc
acgtgctggtaggataacacgtctccatggccagaatttccccatcctta
acctcgtgcaaatgagcgccacaagagtaaatctataccagaatgctatt
ctttcaccattctggaacatcaatgcacacagtgtggtctacatgatcca
agggcatgctcaagttcaagttgtcaataacaatggtcagactgtattca
atgaccgtcttcgccaaggtcagttgctaatcgtaccacaacactacgtt
gttctcaagaaggcggagcgtgaaggatgccagtatatctcattcaagac
caacccaaactccatggttagccacatcgctggaaagagctccattcttc
gtgccttgcccgtggatgtcctcgccaatgcataccgcatttccaggcaa
gaagcccgaaacctcaaaaacaacaggggacaagagtctggtgtattcac
tccaaaatttacccaaacgagcttccaaccttatccagagggcgaggatg
agtcatctttgactaataaggcatcagagtaaattagtgagtgtaatgga
aactagtatagtgaaataaaagcatcgcaagtgtggaagtgggtggtata
taaccgcttatcttaataaataacttcatcatgtt
BLAST
BLAST Search