Query (optional)   in Class  

GrainGenes Sequence Report: X83518

[ Printable Version ]  [ Submit comment/correction ]

Sequence
X83518
Subsequence
X83518_1.cds28129966
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC153995
Data at Gramene
Gramene-Protein Q43484
DB Remark
Locus Source: Hordeum vulgare
Keyword
Knox3 gene
Species
Hordeum vulgare
Cultivar
C1
Clone Library
EMBL4 in NM1149
Tissue
leaf
Data Source
genbankRelease 145, Dec 15 2004
genbankRelease 135, Apr 15 2003
Title
Knox3 gene
Clone
gHvKnox3
Probe
HvKNOX3
HvKNOX4
Gene
Kap (Hordeum)
Gene Class
Hooded/elevated hooded/awned lemma
Gene Product
Knox3
Remark
DB_xref: taxon:4513
[ Show all 10 ]
Reference
ReferenceMueller KJ et al. (1995) The barley Hooded mutation caused by a duplication in a homeobox gene intron Nature 347:727-730.
Allele
Kap (Hordeum)
kap (Hordeum)
EMBL Feature
misc_feature95809861homeobox domainLocation: 9580..9861
[ Show all 12 ]
DNA
gatatctcaaagcttggcgcccctcatagcacacgccccagttgtatgtc
atcggcatccggctgcccttggacgcggttaccgtatcgtcggtcgccag
atgtaggatccggtatccccccgaagctgatcacatcctccatggagacc
tctgtcgagattcagcctcctgcctcattcccgatagtgttcggcctagg
acccggtgatgtgggagctaccggagaatcagctgcagtcacgacccgag
cgactgactcaccggtctcaacctactgcccctccatcgccgtccgagtg
ggaggcgatgagcgaggtgaaggcagatgggcctactcccgccgccctta
ggccccgccccacgagaagaagacatgcgaggtagagttgtgccatgtcg
ctgagcctcctgcctgcaaccggccgacccccccccctcatgtgaacgtc
gcgacatcaccgcctgagaggtagacgatgagcgacatgaaggcgaacgt
gcctcctgcccgcggcccttgggccctgcccctctagtggaagactgctg
aggtggaatcgagccaggtcaccgggcctcctgtcgcaatcggctaaccc
cacccccatcgaagcgtcgcgacttctgtgtgagctatatggggaaggca
ttgtgtggcaatgcgtgacaacaaaatgcagcaatccacacagggaccag
atttaggcgagtgaagctgaatttaaaatctaaaacttacaaatattcgt
tctgtattcagagactagatttagctttgttaatgaagcagaatcgaaaa
gctgaaacaaccaattgttttgaatcaactttgctagtgaagcttaatct
ggattcaacattatctttaaaaaaaattatgcacgagtgtgtgataaaga
gcattccacgttgatgttacatagtattacatgtaaatcaactccacact
cgttccgagtaatacccatggtcagctcaatttttgtgcaattggccctc
aagtatgcaaagcgatcccacgggtgattcgaatcgaatcatcaaaacta
aaacacataaggacgcggaatcagttttgcaagaccaactgcaacggagc
gatctatttcgtccattcatgtctattttacgtttacgtttgatttgtat
ctgttcggacccattttagaacccaaattaagtcatattcatgtccaagg
cgaatataaagatgcctcaactttcttttctgtctgtctatgtcctctgc
tgacctatatggcaaccaaataaatcgtcaatctcaatccatgtgtcgtt
gtgcttgtgtgctacgtagctagccgccggctgagctgtccgccgtgcgt
gctagcgagctagctggagcgagaggggatcggattccccctncggcggc
aacggtatacgttttggtaggagccatgtgctttggcgattctcagctct
ggcatttgacctgctcatagttgtgctccttgcttctatgactctgtccg
tcagctcttgtgcttcggtgtgtctacgtcgcagaagaggaaggtgctcg
agagtagtgtgtccaggcttgtgggtccgctctagttactttttccaatt
cagcttggatgccattcatttgggttctagggtgaatcgagctgccggct
gccggtgcgtcatcctccgagccagggtgaaagggaagggtccctttgca
gcggcggtaacaaatgatgccctggtccatttctgtcttgaatggtggtt
gtgatcacgaagcttgcgcggttatgcattcctccctagcccatagttta
gttttgtcggtctagggcgtcttgtagggtgttggctgcagcgtagtgat
gcttcggctcgcttcctttgctgcctacgagttgtctcacttgagtgcct
tgtatccatcgtcttgttttccttgtaagttggtgctcatgtattcctct
caggttgatgactttgttaattcaaagacagactcttctaaagccttcgt
ttaaaaaaagctagctgctagccaacgtccgaatgagctgcccgtcgtgc
atgcgtgctagctagcatcatcggccaagctattagtcgacgccacgcac
gatatagttcacccaccaaatgtacgattgaatgtcggacatgtcaataa
atgtgtcgacattgttggacgcacctgacgggcaaataaaaaaagtgtct
attaggccgatccaaacatacagccaaggaaacaaaccatacgtccggtc
ggccgattgaagttgctctaggtgaagcgaatatattttcagaatccaat
caaaaactgaagcaaacatgtccccttccaaaaaaacagaaaaaaaccca
acaaaatcagcttcgtctccaccggcgattctacaaaaaattccctacaa
agccactccaagccctgtgatttgaccccaaaaagaaaggagctccctca
gacacagcactatacattgcagtacaacagcgcaccatcctacactacac
tgtctctctctccaaagggcgaggtgtgtactgcagtattgccctccagc
cttttctctcgatcgtccccatccccttccctctaatgatagcttagaga
gagagagagagagaaggagaaaaggctattccgctcaaggcaaggcaggc
aggtacccttctccttccccaaacccaaaccctttttctctttctctccg
cccaagaacttcacctcaagctcaatccgtctccttttgcgcaggagcta
gctcggggacagtgtcgccgggagctcgatcgctgcaccactacatcact
agagataacccatggaggagatcggccaccacttcgggctgggagccacc
gcccacggccagcaccacagccagctcccttggggctcttcgccgctcag
cgccgtcatctcgccgcccccacagcagcagcagcagcaccagcaacagt
ccgccggctatctggcgcacagcccgctctccctaaacaccgcgccgccc
ggggtaagccacggcggcggcagcggctgtagcaacccggtgctgcagct
cgccaacggcagcctcctggaggcgtgcgccaaggccgccaaggagccgt
cgtcgtcgtcctacgccgccgacgtcgaggccatcaaggccaagatcatc
tcccacccccactactcctccctcctcgccgcctacctcgactgccagaa
ggttctagcactagtactagcaacattaacagtagcaccgctgcatctgg
ttctgctcctgctcctgcacgagaagtttctcttctacatctcatgtcaa
acatgaagcatgcatgctttcttgcttgccttttaatagcagctacagtg
catccatgtttattgctgggaagtacttgttcttagccttggtggttgca
ggtgggggcgccgccggaggtgtcggcgaggctgacggcggtggcgcagg
acctggagctgcggcagcgcacggcgctcggcggcctcggcaccgcgacg
gagcctgagctggaccagttcatggtgagccgatcgatcggacttggaac
atttttcctaggttgtgtagctagctagtactactcacacacggtgacct
gttcgttcttcttctgttggtgctcgcgcaggaggcttaccatgagatgc
tggtgaagtaccgggaggagctgacgaggccgttgcaggaggccatggag
ttcctgaggagggtggagacgcagctcaactccctctccatctccggcag
atcgctgcgcaatatcctttccaccggtaaagaaaccagctagctcaaag
ctgctgcagccatccgtccatcaacgattgaatccatccatattccatac
aacctcttgccttttgctattaatttctccatgatttcttcatctgcttc
tcccatctcttgtttcttcttcatcttcttgcgcaacatatataatttat
tggtttcatatagtaaacatatttttttatgtgaaatttcctgggtccgt
gaaaaacaattgcataatataactatcgntttctagtgcatcctggtatg
attgattgtgcctgcatccacatgtgcggaactgtgcgcacgaatgggta
gaaggttttcctcatcagggtgctctnggtgttctaatgtcgcggcattc
ctcgtcagggtttcccccccaaaagattctttcccggcttggccgctggc
tttccctgaaggagcatacgtacgagagattcttctaacctgggcatcca
tggatcttttcttctgctggaaaggaatagtcctctcgctccaaacacat
gcacatcagtttcttccattcacatgcacatcagtttcttcatacacacc
tcgtcatcgnnctccatgattgatgacagattaaccgcacaaaaccatcg
attgatttcgtcctccagatcgatgagttggncgngtagcgtaggtattt
cggttcttggaatttatgcggcgttagagcgattccttttcgggaggagc
atgggcatgtgcctccgagtggttcttgcttccttcagccatcttttctc
tatgctggtgggaggaaacccagccaggcttcttctagggttttgggagg
tgggcactgtgcagcccaacagtgcaaggccgaggagtctcactgccgta
tgtcagtggagcaagtacatgtacacacatgcatgtttagtgagtgttgc
tatgtagggagagaaactcagctcaggctcaggctcaggctcagctcatc
ccccatctgtcacgcaagccagaacaacattcttgtcatctttctccctc
cctcaagaaatccatgcagctacctcttgtcctcgaatctttttgttcca
gggtgtggtcttccagagtactagtacatgcatgcatgtacatattgcat
agatagggtcagacgtgtgttcttagtctttttcttgtagtaatttttaa
atgcacttgtacataaggtgaagacgatgattcatgccagcaggggcctt
tctaaatgacctatcacgaggctatagtggcaactggtactacccacaca
cctgcacagttgttcagtgctcagagttttcactcacttctgctaccatc
tgcactggtcctggtagtactagcactatgcccacgcgatcacttcatta
ntggagcatgcggtncagccatctgatgtgntgtactactagtagatcaa
tagtggttcnttgagatttcnntgaattaaccacnatgcccacncgatca
cctcattgttggagcatgcggtacagacatctgatgtgttgtactactag
tagatcaatagtggttccttgagatttccatgaattaaccaacccctcaa
agttcaggtcaatcctgtgcacaaataaaaaatgaaacgagtagtagatg
catagctagacagatgagtaaatagcatatgtggctggggttagttcttt
gtgtgtgttctggggagttctgaccagttgcagtgcagtggcatggactg
ctagacactggtctatgtgcctcgagaaccatagaaacagtcaagtgctt
gccacagcctacagccaccattatttgatgtgagatctccagcaatttat
gcgtgatctccttggcagcaatattatatgcatgctagctccatctacta
gtgtaggcatgtagctagactagataccatgttgctgtattttgcgacag
ccttatctctggtctctctctctctctcatgaataatggcggtcaagaga
cgttggatgctttccaaggcgagtccaagttcaaacctgtctgcattttt
cagacgtcaactcatatttcttctcagcttaaattgttctttgtcctata
tacttcttgctagactactacatctctacatgtgttctcctttcttttct
tttcagtttttcaagagtatgacaaaatagtttcctaaccacacaagtta
aaagtgcaaacaagggtaaaatgccagactaattaccacaatccatctcc
tgttaatagaatttacaaaatagatgcatggagtttagctcatcagaaaa
caacaatgctttcttttctgattgatgttgcacccgtcctcccaagattc
ttcgttgcatgcattctttcaaggccatgcaaaagcaggggacacagata
tcacgagtttccgtttgtcttgaggtaaggccaaaagagatactgaaaac
ttgcctggtggtaaaaagcaaccaaaagaaaacaaaagggtaaagggctg
acgagtttgcattggaatgtcactggaaaagacaatgcaactggagaaaa
aacacatgcatgacttgacgatttgatgctttcatcttcatgcatgtctc
cgttagcaaaatcctacagataatcatttgcacctcattggtttctgtgg
ttcctactagatctcaggttttatccaaacttccatcggaagtaattctg
tggctggcaaatccatgatcatttgcttctgctcttagcctaataagctt
cattcatgccttcccactgcatacaataccatgtccaggttctgtacgac
atgcctagttatatatactccacactcttctggttttatttgataatgca
tgtatgagcaaaaatgctgtttggagctcggcctccatggaggccggttt
ttgnaaaacccgaaattcatcacaattcatatttttacattccaaaaaag
tctgaaaacaaatacgtatattcatggaggcataacacacatgtttggaa
atttttagaacgaaatacgttgaaacgagggctgtgcagaaaagacaaat
ctgcggcttttaacacatgatactattaatcacaaaagtccatggatttg
ttatttttgcacagatcacatctctaggtatttcatcctgaaattttgca
cacatatacatttcatccttgtatacttgcatattttttctcagatttgt
ttgaaaccaggaagtttggatgttgtatttttcaaaaataaagggtccat
ggaggctgagctccaaaaggccctactcttgtacgaggtttttatatttg
ttgcttcagtttttttttttttttaaaactggcttgttttatataatata
tccagtaataattttatgatgcgactcctgtggcattgctctagggtgtt
tttcgtggtactactttagactgttctgcggagtaattgttcaaatcgta
tactccctctcttccaaaataagtgtctcaactttgtactagctctacta
caaagttgtactaagcttgagacagttattttgagatggagggagtatat
cctaattactagttagtaatagttatcaatgattctcagggaacagttct
atgtcactttcaaatgcattgttaacacattgtgtcacaagatgtggctt
gtttctatatagctagacnatatagctttgctcctgcgaaggcatggtna
tactacatgtgaagctaatagccatcatttttaacacccctaggcacctt
atttgtcacgagtattttagcattatcttanatagtactcccttgtgaac
taatataagagcgtttagatcactactttagtgatctaaacgctcttata
ttagtttacagagggagtatttgtcagcagtagtgaatcttctctttgtt
tttagcatgcaagcctgcttatcaaagtcttgtatcctaacttcctaatt
agtccagtataataccatatgcatagggcattgagtgcctctcggcttat
acatttgcaaaataaagttgcttacccatgcatcaacataacctaaacct
gaagaaaaatgacattactaacaacattggccacctcatcgtaaggtgct
cagatatggtcatgtactgatctgcnctatatgtataggacgccataatt
tatttataataatatgttgtaaaatcatgagatacgtgtaatttatttna
aatgaaattattttttgtgccaaatttgttacttcattttcatctggtca
atccatataatctaatatgcaaaagctgaaaagctcttaagattgacagc
acaaattggcaatatttgaccacatattgtgtcaaccctcacggcaactt
gtgggtgcatatgtatagatagtgaactactccgtcctataatataagat
ggattttaagactacactagtgtaaaaaacgctcttatattatgggacag
agggagtaccatgtaagatggaatttcttaactaagagaagtggcctatt
tggatccctaagttgacatgtattagtgaagtcatacatagttaagagag
gcaagtgctccacttaagaaacttgtagtaggtaaacataacttcgaata
acctgttataatccactaattattttggcaagatcaacattttctcacac
aattcaacatttgttcagtttacacagtcattaatggggccattaaacca
ccttaaaaatttccttaagccgcttatagtcattagggtttccatctgag
gttttaggtaggagggcacggctccccaatcacataaaatgtttcacata
gagnctagcttaagatgtgcggccttctcttcgaactctatttatgggac
ttatattttaaaaaaattccatatattcttaaaagatcaatccacacacc
acacaccttataaatattttcttataccatgaatatgtggagttatatta
aaaaatccatatattcttaagagatcaatccacacaccacacaccttagg
ctctccgaaatggagagtatcatatactagtatcatgcatatgatattag
tgtatgatactacttcggtaatgcatagtctagattgccttgttaattac
catgcatgacacaaattagtataacatttaatatgataccacatcccttc
tttcctcatttaataatgtgccacattatcaaataagcctagttggtatg
catgatactatttatgatactctcattgcgaccagccttataaacatttt
cctataccattaatatgtggacttatattaagaaatccatatatacttaa
ncgaaggtacaccttactaattgacgcatatagtattcacaaatggctag
tataccattaatatgttgagttattaacacatgaatatagtattcacaaa
tggctagtcttcatgcagaattaatttccctattatttcacttcgcacag
ctgcagtagctaattgatgtttcactaatccatgaagacactctcttctt
ttgtcttccttcctattatcgtgtggaactataaatctggcttcatcatt
gttacatacttgtcaagatatatataagcttaatgtgcctacaacctaca
ttgatcttgctatgcgaaagtgagtccataccttgtttcttgcttcacta
acaaattccatttgatatgtgttgaatctgtaaattaaggatcatccgag
gaagatcaagaaggcagcggaggagagacagagcttcctgagattgatgc
ccacggagtggaccaggagctgaagcaccatctcctgaagaagtacagcg
ggtacctgagctccctcaagcaagagctgtcaaagaagaagaagaaaggc
aagctccccaaggaagctcgccagcagctcctcagctggtgggagatgca
ctacaagtggccttatccctcggtaaacaaaccttcctacgtttccacac
tctgaacatttctagaacttctctttttgatataaaacttaacgattagc
gctgtcaaacaggagagccagaaggtggcactggccgagtcgacgggcct
tgacctgaagcagatcaacaactggttcatcaaccagaggaagcgccact
ggaagccgacggacgagatgcagttcgtgatgatggacgcttaccacccc
cctaacgccgccttctacatggacggccacttcgtcaacgacagcgggct
ctacaggttcggctagctcggccaggcctcgtctcctaccggtgacctcg
gtcggcgccaatggcggcgaccgagtgccttatgctgaagcacatgggga
ccgacgaccgaagctagttaagttagcgtttgtgtgccgcatgcgagctg
gaaggaagccgtatgcttattttgttaatcatcactacttacggacgtac
ctatcatttatgcatagactcgatcgctttcgtgtggttttgtggcgatt
gacgcgaccatatggacaacagactgtttgctgcgacataccttgctacg
tgcatgcttgaataatttggctgctctctacctacatatgcttctttctg
aatttgttcatgcgtgctaaactgctaatgatcggtatggatatggtgca
agggaacgatccaaagtactttgtgcttgaatcgttggccgttttgttct
ttgactgcttcagtagtttggtgtcagttgagccattgcaggcagttcga
ctgggtcagttgacattatttggttgaattatgttgctcgtaagtatatc
acgtgtgcaaataatgggccggccaggtgtacactcatatcctttgagca
cgcagaatagcaacaattttggtctcagtcacttgagaaaattggttatt
tggcacattcaataccggcttcggaaaattggcactttcaacgttggntt
tggaaaattggcactctgcttgttggtttcttgattaacataccacttct
ctctttttagtgatttcctttttcttttttacatttataagtacaanaaa
agaccaaactactcttgattgtacatacatctgattatctgtatggagca
gggaagaacaagctg
BLAST
BLAST Search