Query (optional)   in Class  

GrainGenes Sequence Report: Z15131

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Z15131
Subsequence
Z15131_1.cds281032
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
Data at Gramene
Gramene-Protein Q42518
DB Remark
Locus Source: Avena sativa (oat)
Keyword
beta glucanase
lichenase
Species
Avena sativa
Clone Library
Unizap
Tissue
Leaf, etiolated
Data Source
genbankRelease 145, Dec 15 2004
genbankRelease 141, Apr 15 2004
genbankDownloaded 2008-2009
Title
A.sativa mRNA for beta glucanase.
Strain
ogle
Clone
pOGL1
Gene Product
(1-3, 1-4)-beta-glucanase
Remark
DB_xref: taxon:4498
[ Show all 11 ]
EMBL Feature
mat_peptide1121029Location: 112..1029
polyA_signal13241330Location: 1324..1330
polyA_signal14251431Location: 1425..1431
sig_peptide28111Location: 28..111
DNA
acgagagagaaagagttttgagtcccaatggcgagccaaggtgttgcctc
catgttcgctctcgcattgctcctcggagccttcgcctccatcccacaaa
gcgtggagtccatcggcgtttgctacggcatgagcgccaacaacctgccg
gcggcgagcaccgtggtgggcatgttcaagtccaacgggatcaactccat
gcggctgtacgcgccggaccaggcggcgcttcaggccgtgggaggcacgg
gggtgaacgtggtcgtcggggcgcccaacgacgtcctctccgcgctcgcc
gctagccctgccgccgccgcctcctgggtgaggagcaacatccaggcgta
cccgaaggtctcgttccggtacgtctgcgtgggcaacgaggttgccggcg
gcgccacccagaacctcctcccggctatgcagaacgtgcagggcgcgctg
gcgtccgcggggctggggcacatcaaggtgaccacgtcggtgtcgcaggc
catcctgggcgtgtacagcccgccctcggccggctccttcacgggcgagg
cggacgcgttcatgggccccgtggtgcagttcctcgcccgcaccggcagc
ccgctcatggccaacatctacccgtacctggcctgggcctacaacccgag
cgccatggacatgagctacgcgctcttcaccgcctccggcaccgtggtcc
aggacggcgcctacgggtaccagaacctgttcgacaccacggtggacgcc
ttctacacggcgatgggcaagcacggcggcgccggggtgaagctggtggt
gtccgagagtgggtggccgtcggccggcggcgaggctgcgacccctgcca
acgccaggatctacaaccagtacctgatcaaccacgtcgggcgcggcacc
ccgcggcacccgggcggcatcgagacctacgtgttcgccatgttcaacga
gaaccagaaggacaacggcgtggagcagaactgggggctcttctacccca
acatgcagcacgtctaccccatcagcttctgatcgaacgaacgatcagag
gtagctgggctggtggctatacccgtatgtccgtacgcgcgcgtacatgc
gtataagggcgtgtacgcgtacgtatgtgcacattatgtgtttgtacagt
acaggggcttgatgcgaccgctgagacagtatgcagtactactcagatgc
gtacgccatagtagtgggattggtaccgtataccctagtagtatactagt
agtaatctagtatacgattgcgattgaagggaagcagatgtaaacgctcc
cttcctagtggagaaggctgattgatataaggatgctacacagatgtgta
cgtataggtgtagggtctactatattgtagcagggttcaaagtttcgtca
aattttgatgaaatttttgttcgaaaataaaaaaaaaaaaaaaaaaaa
BLAST
BLAST Search