Query (optional)   in Class  

GrainGenes Sequence Report: Z22874

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Z22874
Subsequence
Z22874_1.cds511055
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC277855
NCBI UniGene
Ta.10
Data at Gramene
Gramene-Protein Q7DLM1
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Beta glucanase'
Keyword
(1,3
1,4) beta glucanase
Species
Triticum aestivum
Chromosome
group 1
Data Source
genbankRelease 144, Oct 15 2004
genbankRelease 145, Dec 15 2004
genbankRelease 135, Apr 15 2003
Title
T.aestivum (1,3;1,4) beta glucanase mRNA, complete CDS.
Strain
Millewa
Clone
lambda LW1
Gene Product
(1,3;1,4) beta glucanase
Remark
DB_xref: taxon:4565
Feature: mat_peptide: EC_number = '3.2.1.73'; function = 'cell wall metabolism'; evidence = experimental
Feature: mat_peptide: EC_number = '3.2.1.73'; function = 'cell wall metabolism'; evidence = experimental
Feature: source: mol_type = 'mRNA';
Feature: source: mol_type = 'mRNA'
EMBL Feature
mat_peptide1351052Location: 135..1052
sig_peptide51134Location: 51..134
5_UTR150Location: 1..50
3_UTR10531426Location: 1053..1426
DNA
ccacatacacacacccacacaccctcaacgcagctagagagacaaagaga
atggcgagccaaggtgttgcctccatgttcgctctggcattgctcctcgg
agccttcgcctccatcccacaaagcgtcgagtccatcggggtgtgctacg
gcatgagcgccaacaacctgccggcggcgagcaccgtcgtcagcatgttc
aagtccaacggcatcaactccatgcggctgtacgctcccgaccaggcggc
gctgcaggccgtcggcggcacgggcgtcaacgtcgtcgtcggggcgccta
acgacgtgctctccaacctcgccgccagcccagctgcggccgcctcgtgg
gtcaggagcaacatccaggcctaccccaaggtctccttccggtacgtctg
cgtcggcaacgaggtcgccggcggcgccacccagaacctcgtcccggcca
tgaagaacgtgcagggcgcgctcgcctccgctgggctgggccacatcaag
gtcaccacgtcggtgtcgcaggccattctcggcgtgtacagcccgccctc
cgccgggtccttcaccggggaggcggacgcgttcatgggccccgtggtgc
agttccttgcccgcaccggcgcgccgctcatggctaacatctacccgtac
ctggcctgggcctacaacccgagcgccatggacatgagctacgcgctctt
caccgcatccggcaccgtggtccaggacggctcctacgggtaccagaacc
tgttcgacaccaccgtggacgccttctacacggccatggccaagcacggc
ggctccaacgtgaagctcgtggtgtcggagagcgggtggccctcaggcgg
cggcacggcggcgactccggccaacgccaggatctacaaccagtacctca
tcaaccacgtcgggcgcggcaccccgcgccacccgggcgccatcgagacc
tacgtcttctccatgttcaacgagaaccagaaggacagcggcgtggagca
gaactggggactcttctaccccaacatgcagcacgtctaccccatcagct
tctgatgagctagctgcgtatgcgtagctagtgtccgtatgtccgtacgt
acgcgcgcgtacacgcgtataagagcgtgtatgcggtacgtatgtgcaca
ttatgtattgtacagggtttgggttggggtgcgaccgctgaggcagctca
gatgcgtacgctatagtagtggtttgctgtagtagtgtatgtgtatgatt
tacgatggaagggaagcagatgtaaacgctctcccttcgtcgattcatca
tacatttgatacgtacacacatgtgtgcgtaagtagaactatattgtagg
gttcaaaatttcgtcaaaatttgacggaatttgtccaaaataatatgaaa
tatatcggcgagaccgaagtattcct
BLAST
BLAST Search