Query (optional)   in Class  

GrainGenes Sequence Report: Z26333

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Z26333
Subsequence
Z26333_1.cds12401734
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC154319
Data at Gramene
Gramene-Protein P35793
DB Remark
Locus Source: Hordeum vulgare subsp. vulgare
Keyword
pathogenesis-related protein
Species
Hordeum vulgare subsp. vulgare
Cultivar
NK 1558
Clone Library
Clontech barley genomic
Tissue
Leaf
Data Source
genbankRelease 145, Dec 15 2004
genbankRelease 135, Apr 15 2003
Title
H.vulgare gene for pathogenesis-related protein.
Strain
vulgare
var. nk1558
Clone
prb1
Gene Product
pathogenesis-related protein
Remark
DB_xref: taxon:112509
[ Show all 13 ]
EMBL Feature
CAAT_signal10811089Location: 1081..1089
[ Show all 7 ]
DNA
ggagaaataagaactcttgatattcacttatatctttttgagagtgttct
ctttgagtaacttggtagttgccttgtgctatgaaagtagtcctaaagat
gataggcatccaaagaggatacaataaaacttccatattcttgtgcattg
attagaaagagaagtttgattcctctcaattagttttgagatatggaatt
ggtaatattaagagtcatgttagtagggtgttgtgaatctagaaatactt
gtgttgaagttagtgattcccgtaacatgtcgtatggtgaaccgctatgt
taggaagtcggagcataattgatttattgactcgtcatcctttgtgttgc
ggacgggatcgcgcgatggttaacacctaccaacccttcccctaggagta
cgcatttagcactttgtttcgattactaatcaaaactttcgcaataagta
tgtgagttgctttatgactaatgtgagtccatggtatagatgcactttca
ccttccaccattgcaagcctctctagtaccgcgcaactttcaccggtaca
caaaaccaccatagacctttcctcaaaacagccaccatacctacctatca
tggtcttttcatagccattccgatatatattgccatgcaactcccaccgt
tccgtctcatgacttgtgccgtcacttacatattgccattgcatgatctt
aagatagctagcgagtcatacgctaagctagatcgttgcacatcccggta
tactgcaagaggcacttcctatagagtcatcattgttctaagcattgaga
tgtgagtaaataaaagtgtgatgatctctagcgcgcgtggtcgtctaaca
acttgagtttgagggcaaacaatggaatggtccaattttgcatgctccta
acgaaccgtgcgtacgtgagatacgtgagccactcacggcctaatgggtt
ctccttctggataggggcgtagattaaccatgcatgtgttgactggacta
gttatcaagttccaaatgagagagactcgatcgagtttcctcatgcatgt
acgtcttgttcgtggaattctttgacactccaagaaaattccttgccatg
gcgcaagactttccacgcaagctgcagacatttctcgcacaaatccacta
taaaaacacctctatactcaagctatacgtacagaagcaaagctggtata
gagcaggcccatagaaatcatttatacaccgaaccgagaatgcagacgcc
caagctagtcatcttgctcgccctagccatgtcagccgccatggttaacc
tttcccaggcgcagaactcgccgcaggactacgtatcaccccacaacgct
gcccgcgccgccgtcggcgtgggcgccgtgagctggagcacgaagctgca
ggcgttcgcccagaactacgccaaccagaggatcaacgactgcaagctcc
agcactcgggcgggccgtacggggagaacatcttctgggggtcggctggc
gcggactggaaggcatcggacgcggtgaactcgtgggtgagcgagaagaa
ggactacgactacggctccaacacctgcgcggcggggaaggtgtgcgggc
actacactcaggtggtgtggcgcgcgtcgaccagcatcggctgcgctcgt
gtagtctgcaacaacaaccgcggcgtcttcatcacctgcaactacgagcc
ccgcgggaacatcgttggacagaaaccatactaaccgtgatgcacgtctt
cagagtacatacatgcatgcatacatatagtctctcgttcctaatctcat
gcacctttgtattcctaactagctagagggacgagcgagtaaataaaagg
aatgccgtaataagccatgtattccatcctggactataataaataatgag
ctcttatatgacctcga
BLAST
BLAST Search