Query (optional)   in Class  

GrainGenes Sequence Report: avgbs2_113081.1

[ Printable Version ]  [ Submit comment/correction ]

Sequence
avgbs2_113081.1
Species
Avena sativa
Probe
avgbs2_113081.1
DNA
tgcagctgctcccgtcgcctccgcagccgtcgacgggtgcaagttcgaga
gcgcgRccgagatc
BLAST
BLAST Search