Query (optional)   in Class  

GrainGenes Sequence Report: avgbs2_200775.2

[ Printable Version ]  [ Submit comment/correction ]

Sequence
avgbs2_200775.2
Species
Avena sativa
Probe
avgbs2_200775.2
DNA
tgcagttttttcaccactgttagatctccacagcaagcccaccgccgaca
caagatcatcctaS
BLAST
BLAST Search