Query (optional)   in Class  

GrainGenes Sequence Report: avgbs_205822

[Submit comment/correction]

Sequence
avgbs_205822
Species
Avena sativa
Probe
avgbs_205822
Remark
SNP = [C/T]
Type
SNP
DNA
TGCAGGGGGTGAAGCACGTGATCATCCACGGCGTGCACGTCCACCACTCC
GCGCCACAYTCCGA

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.