Query (optional)   in Class  

GrainGenes Sequence Report: i_11_10003

Sequence
i_11_10003
Species
Hordeum vulgare
Probe
i_11_10003
Remark
E-value: 4e-124, Bitscore: 442.0
DNA Homology
AK248169.1BLASTN
DNA
cctccgcttccccggccagctgaactctgacctccggaagctcgcagtca
acttgatcccattccctcgcctccatttcttcatggttggctttgcacca
ctgacctcaaggggttctcaRcagtatcgcgccctcactgttcctgagtt
gacccagcagatgtgggactcaaagaacatgatgtgtgctgctgacccgc
gccacggtcggtacctcacagcctctgccatgttccgtggt
BLAST
BLAST Search