Query (optional)   in Class  

GrainGenes Sequence Report: i_11_10005

[ Printable Version ]  [ Submit comment/correction ]

Sequence
i_11_10005
Species
Hordeum vulgare
Probe
i_11_10005
Remark
E-value: 1e-119, Bitscore: 427.0
DNA Homology
AK372355BLASTN
DNA
caaaggcaaggactttgtcgagcccttctctccMaacaccgtgcacgctc
cMtgggacagcaggactaccacccctaacaccagccagtagtagattaga
tcagtgtttgcggccggtccRgtttttattttatcactagtgagagctgc
tcgccgcgtatgaggcgatccgacgattttttttcccctttccaggtgat
gtaaatatgtgcttgtttttttgaactgcttagagcagagg
BLAST
BLAST Search