Query (optional)   in Class  

GrainGenes Sequence Report: i_11_10010

[ Printable Version ]  [ Submit comment/correction ]

Sequence
i_11_10010
Species
Hordeum vulgare
Probe
i_11_10010
Remark
E-value: 4e-119, Bitscore: 425.0
DNA Homology
MLOC_61018.1BLASTN
DNA
ggcaggtggcatcWctSacgttacgRatggcggacgggctcccggtgcgg
gtgaatgccagagggaattgagtacgacgacaaaatgcagggaaaaatct
gctacgtaattgtgtagaaaRccgtcactatgtaaaagatggattcacta
ggcctgatttctgattgtttcaccaggcgtttctacttggtatgttggtc
catcgtcaagctcgatcttctggtggatttccatgccatga
BLAST
BLAST Search