Query (optional)   in Class  

GrainGenes Sequence Report: i_11_10011

Sequence
i_11_10011
Species
Hordeum vulgare
Probe
i_11_10011
DNA
tttttttttttttttttggcagtaactgatagtagcatagcaaaactgta
gttgtctcttggttcacagatgagaacgagaagagatacactattttcta
ggtaataccgtatttttStttcttgagaaagcacataccggatttatgaa
gaagggcggggagcaccggtacaaggataaaagcRcacacacacggacac
accgctccttatctaacagacacacactcacgccatca
BLAST
BLAST Search