Query (optional)   in Class  

GrainGenes Sequence Report: i_11_10013

Sequence
i_11_10013
Species
Hordeum vulgare
Probe
i_11_10013
Remark
E-value: 6e-123, Bitscore: 438.0
DNA Homology
MLOC_2075.1BLASTN
DNA
tctgagttccagaagaagatcttcgacattttgtacaaggtcgcagacat
cccgttcttggaaccatacaagaccaagatYattgaagtgattgagaagg
gagagacgcagccgaacattRcaatttcgattctggcctccgtcgttgtc
gtcattgtgactgtactcttcagaaccttgtttggtggcaagaagccagt
ggcacctgtgaagcccgctgctgagaccaagaagcccagtg
BLAST
BLAST Search