Query (optional)   in Class  

GrainGenes Sequence Report: i_11_10017

[ Printable Version ]  [ Submit comment/correction ]

Sequence
i_11_10017
Species
Hordeum vulgare
Probe
i_11_10017
Remark
E-value: 4e-124, Bitscore: 442.0
DNA Homology
AK353943BLASTN
DNA
aatgggcaagcacgaacttgggctcaaaaccaacataccccagatataga
tgcccattgtcgggcaaatgatgcaggatcaatcgacaagtgagcgcatc
ccctggtaaatcgcgccaggRcgaagatcgtccagagtatcagcgactct
gtagccactatactccctgaggagtgtccaaccacgtcgtgacagaaaat
ctctgaagtcgtcttcggtgtagaatgttttatcttctgtc
BLAST
BLAST Search