Query (optional)   in Class  

GrainGenes Sequence Report: i_11_10026

[ Printable Version ]  [ Submit comment/correction ]

Sequence
i_11_10026
Species
Hordeum vulgare
Probe
i_11_10026
Remark
E-value: 2e-118, Bitscore: 424.0
DNA Homology
MLOC_10457.2BLASTN
DNA
tagtacacataataaacataaacacaggagaaaaaaaggagtYtYtcttc
atYttcgccagcttcctccacgccgagaggagccacgtcgagatttctYt
taggcggacttcacggSggcRgcgttgattatgtcgatgaactccggctt
caaagaagctccaccgacgaggaaaccatcgacgtcggcctgcgcggcca
actccttgcagcttgcgccagtcacagatcctccatagatg
BLAST
BLAST Search