Query (optional)   in Class  

GrainGenes Sequence Report: i_11_10050

Sequence
i_11_10050
Species
Hordeum vulgare
Probe
i_11_10050
DNA
atggtggtctgtgtttgaacaggctatcatctcttcgggtggaaaactag
caaagccagagatcttatcttcaaccacggacgcccgattcgtgaggcag
atgggtgttccagcccttggRttttctccaatgataaatactccaatatt
gcttcacgatcataacgagtttctggaggataaagtgttcctgaggggca
tcgaagtgtatcaacatcttatcagagcgctgagctccttc
BLAST
BLAST Search