Query (optional)   in Class  

GrainGenes Sequence Report: i_11_10061

[ Printable Version ]  [ Submit comment/correction ]

Sequence
i_11_10061
Species
Hordeum vulgare
Probe
i_11_10061
Remark
E-value: 6e-123, Bitscore: 438.0
DNA Homology
MLOC_51757.1BLASTN
DNA
atcgtgctccagatcacatttttgctactggcgttctgcttcaccgcgat
gctttacctagcctttttttcaagcgactttgtgatcgtcgggcacgtcc
ttctgctcataaccatcggcRcggttctattcgtgctcctcaacaggttc
ctcgcRgagaccggcttcgtcccagtcgaacagcagatgcaggagatggg
gatccacaaaccagaagccgcagagaaagacaagagcaact
BLAST
BLAST Search