Query (optional)   in Class  

GrainGenes Sequence Report: i_11_10111

[ Printable Version ]  [ Submit comment/correction ]

Sequence
i_11_10111
Species
Hordeum vulgare
Probe
i_11_10111
Remark
E-value: 7e-122, Bitscore: 435.0
DNA Homology
MLOC_66415.3BLASTN
DNA
ctcttggtcataggagtggcattccttgaacaccttggtgtaaaacctcg
gctcccggtagtgcgtcgggttcactttcctcttggaatcMccagactgR
tggaagcacgattccctgatRaaaatatgtccaccaggcttcagccactt
cactattctgccaatcagcttctcaacctcctcgtcgttgaggtacatga
gcagccagttggagaagacgatgtcgatggagttgtcctcg
BLAST
BLAST Search