Query (optional)   in Class  

GrainGenes Sequence Report: i_11_10518

[Submit comment/correction]

Sequence
i_11_10518
Species
Hordeum vulgare
Probe
i_11_10518
DNA
gcccaaaagatgatggcgatgggcggtggaatgggctttaatccagcaat
gagcttgagcgcagagaaagacagcctcgacatcatccagcatgactggg
ctttaccaaagatggagcgtMatgccgaagacgtgttgaggaaactactg
aagaattgagctgaacaagcaccactaggccctScaagttttgagtttag
cttatcRactgatcagacagttatacttctgtaattgtatt

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.