Query (optional)   in Class  

GrainGenes Sequence Report: i_11_10778

[Submit comment/correction]

Sequence
i_11_10778
Species
Hordeum vulgare
Probe
i_11_10778
Remark
E-value: 4e-124, Bitscore: 442.0
DNA Homology
AK250137.1BLASTN
DNA
gtgccagtaccacgacagataggacattgcaatagcaatacagcgacaga
ctcaattgacagaaaatagcgcagctctcttagcagcataagcaaactag
accatgtaacagaatcaaaaRtttagagcttgtcctcaaaatcagataga
ggggtcatctgttccttgagacccttgcgcttgcggatctccgtgacaag
ggtggcagactgggagccagcctccaaaggatcagaagaca

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.