Query (optional)   in Class  

GrainGenes Sequence Report: i_11_20536

[Submit comment/correction]

Sequence
i_11_20536
Species
Hordeum vulgare
Probe
i_11_20536
Remark
E-value: 7e-122, Bitscore: 435.0
DNA Homology
AK367079BLASTN
DNA
gaatccaatggcaatagcagcttctgccttggctccataYaccagcctct
tgatccgggatagatgaacagccccaaaacacattgggcaaggttcacat
gatgcgtacatttcgcaatcSgacagctcaatctttccaagctttttgca
agcctctcttattgcagtgacttcagcatgtgcagttggatcggtgttgt
tcagaaccatgttatggcaaccRactattacttcgtcatta

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.